Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20101  (registered. 2003)
Contig Information
Length 1565 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit Os11g0614400 [Oryza sativa (japonica cultivar-group)] >gi|77552020|gb|ABA94817.1| Patatin-like phospholipase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113645490|dbj|BAF28631.1| Os11g0614400 [Oryza sativa (japonica cultivar-group)] >gi|125577199|gb|EAZ18421.1| hypothetical protein OsJ_032630 [Oryza sativa (japonica cultivar-group)] >gi|215765027|dbj|BAG86724.1| unnamed protein product [Oryza sativa Japonica Group]
Score 825
Evalue 5.29715e-171
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20101
CGAGCAGCGCACGCCCGGGAAATCTTGACTAGCACCAGCTTAGCTAAAGCTCAATAGAGCGCTGTGCCAAGAAGCAGCTAAAGATGTGCAGCCATGGCCA
CGCGGAGCCGGCGACGACGTGCGTGACGTGCCCGCCGCCGTCGCAGGGGCGGCTCATCACGGTGCTGAGCATCGACGGCGGCGGCATCCGCGGTCTCATC
CCCTCCACCATCCTCGCCTGCCTCGAGTCCAAGCTCCAGGAGCTGGACGGGCCGGACGCGCGCATCGCAGACTACTTCGACGTGATCGCCGGGACGAGCA
CAGGCGCGCTGGTTACCTCGATGCTGGCGGCGCCCGGAGAGAACAAGCGGCCGCTCTTCGAGGCCAAGGAAATCAACAACTTCTACCTTGAGAACGGGCC
CAAGATCTTCCCGCAGAAGAGCTGGGGATTTCTGACCCCGATGGCGAATATGTTTGGCGCGGTGATGGGTCCCAAGTACGACGGTAAGTTCCTGCACGAC
AAGATCAAGAACCTCACCAACGACGTCACCGTCGCCGACACCGTCACCAACATCATCGTCCCGACGTTCGACGTCAAGTACCTGCAGCCGATCATCTTCA
ACACGTACGAGGCCAAGGTGGACCCGCTCAAGAACGCGCACCTCTCCGACATCTGCATCAGCACATCGGCCGCGCCCACCTACTTCCCCGCGCACTACTT
CACCACCCCGCGACCCCGCGGGCAAGCTGCCGGACCGCGAGTACCACCTCATCGACGGCGGCGTGGCCGCCAACAACCCCACCATGGCCGCCATGTCCAT
GATCACCAAGGAGGTGTTGCGCCGCAACCCCGACTTCACGCACGGCAAGCCCGCCGAGTACGGCAACTACCTCATCATCTCCATCGGCACGGGGTCCGCC
AAGATGGCGGAGAAGTACACCGCGCCCGACTGCGCCAAGTGGGGCGTCCTTCGATGGCTCTATGACGGCGGCTTCACCCCGCTCATCGACATCTTCTCCC
ATGCGAGCGCCGACATGGTCGACATCCACGCTGCCGTGCTGTTTCAGGCCCTCCGCATTGAGAAGAACTACCTACGCATCCAGGACGACTCGCTCACGGG
GCACACATCCTCGGTCGATATCGCCACCAAAGAGAACATGGAGGCGCTTATCGGGATCGGTAAGAATCTGCTCAAGAAGAATGTGTCCCGGGTGAACATT
GACACAGGGATGTATGAATCCGTCGAAGGTGAGGGCACCAACGAAGAGGCCCTCACGCGCTTCGCCAGGAAGCTCTCTGAGGAGCGCAAGCTGCGCCAAA
CCAACCTCAACTCCAAATAGAGAAGAGGACGATTTGAGCGAAAGAGAAGAGAGACGAAGAAGCACTAGCTAGCTGCTATGCTTAAGGATGCAAACGGCCG
ATAATCTTTGTTATTTTAATAACCGTGCATGTTTTAATTATGCTTTCATGGACAAACGTCGACGCTGTCCATTTGCATCCCTAGCTATGCTATAGCTAGG
TCGAGAGTTGTAATATAATGTAATGTGGGTGGGTAATTATTATTTTTAAATAAAATCTGAGTGTG
page-top