Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20041  (registered. 2003)
Contig Information
Length 892 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein OsJ_027849 [Oryza sativa (japonica cultivar-group)]
Score 373
Evalue 6.73043e-34
Total Hit Count 74
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20041
GCAGGGTAATTATGGTGTTTGTGATTCCGAGGGCTCCGCTTGGAGGATCAGCTTTGGTTCAGACTTCAGAGGCAGGTTTTGGGCATACCGCAGCACAAGC
AGAGGCAGATCTCAGTCAATGCTACTGCAGTTGATGATGCCCTGAAGCTTTCTTCAGTAACTGACTCAGCGTGCTGCTGTTCTCTAAGGTCGTTGAGTGC
TGAGAACAGGCAATATAATTAGGATTTTAACGAGAAGTTGGAGGAGATAAAAACTTTCAGGAAGTGTTTAGGCGAGTTCCATGCCGAAAATAATGTTATG
TGAGCAGAGAGTGCAGGCTTGTGCTCTTCTGTTGAAGAGCTTGAGCATGAGAGATTGAATCAACACATAAGTCATGAGAGCATATCTTTAGACGAGGAGA
GGCGACTGGTCAAAGAAATTAAGACCCTTGAAAAAACCAGACCGAGGGTCAGTTCCAAGGCTGCTAAGCAAGCTAAAATGCAAGATATAGTGGTTGAGAG
AGATGCCATACAGGATCAGGTGAAAATCATCATACATGGACTAAAGGAGGGAAAAGCAGCCAGGTCTAAGATTAAGGTCCTGGGCGATAAGGCGATGGGC
GTGGAGAGCTGCTACGAGCTTGCGCAGGCGGCGTACTCAACCTCGTGCTGCACACGCTCAAGCACCTGGCGGCCGTCGTCAATGGGCTCCTCGTCCATGA
TTACCTGGACAACATGAACCTCGAGGAGGTTGTGAAGGGGAACATCTGTGACGCCGTTCTTTAGGTGCTCGCCCATGTCTATGTAATTATCTCTTTATTG
CTTCTAAATTAATGCCAACAGATTAGCGTGCTTCTGAGATATCTTCCAAGTTACTGGTAACTACAAAAATTAGACCATATGTTGACTTCTAC
page-top