Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig20016  (registered. 2003)
Contig Information
Length 558 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 2
Homology (BLAST) Top Hit tubulin alpha-6 chain [Zea mays]
Score 404
Evalue 6.29292e-38
Total Hit Count 22
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig20016
AGGCGGAGGAAGGCGGCCAAGGGGGAGAGGCGGGGAGGAAGCGCGGGGTCGGTGCGGCGGCGGCGGAGTTCGAGATGGCTGCGGCCGGGCCGGACGGGCA
GAGAGAGCGGTCCATGGCGCTCAACAGCGAAGGCCTTGAGGGTCTAGTACCACGGGCAAAGCTGTTACTATCACTTGGTGGTACTTTTTCCCTGGCATTT
GGTCCTCTGATTATTGTCACGGTTTCTCTATTTGCTGGTCTTTATCTGTATTTTGGGCAAAGCTTTGTACATGACGGGAGCAAGAAACCAGTGGCGCCAC
CACCATACATTGATCCATATGAGCTACTGGAAGACGATATGATCTCCCGGCCCTCCCTTGATGTGTTCTGAATCTCCACGACACAAGGATAGTATTTGTA
GATAGCTCAATAATTTTCTTGTTTTACTAGATATGTACCTGTAAATGCAATAGCTGTAGACTGTTATTATCTAAAACTTTACAATAAAATTTGCGAAAAA
TCTCGCGCCAAAATCCAGTTGTGGTGAAATCTTTCCCAACCTTTCTTTAAAAAAAAAA
page-top