Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7344  (registered. 2012)
Contig Information
Length 637 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_SH - 1
Wh_VABA Shoot with ABA treatment 2
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 1
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|37783283|gb|AAP72270.1|| ribulose-1,5-bisphosphate carboxylase activase [Triticum aestivum]"
Score 286
Evalue 1.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7344
CAATATCTTTATATATTAACAAAACATGCCCAGCAATCGCTTGGATGCGATGCGGTACTTAGGTACAAAGGATAAAACATCAGATATTAAATTGGCATGC
TTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTCGCCGTTGGGTCGAAGTTCTTGGCAGTCTGGTCGGTGCATCCTGCCGGTACAGGCAAAGTACCT
TGCTGTGCCCCTTTACCGTAGAAGGTACCAGTCTTCATCGCATCCTGGTTAGCATCACCCAGAGCTGCCTGGCTCATGTAGGTGTCAGCAAGCTGCACAC
GCTTGACATTGTCCTGCTCCTGGACGAGCATGTGCCCGTACTCTAGCAGCTTCTCCACTGTCATCTTTGGCTGCTCAAAGGTCACTGGTCCGTCCCGCGA
GTTCACCAGCTTCTTGCCAATGTTCTCGATACCGGTAGAGGTCACCCACTTGCGCACCTCGTCGTCGTACACCCGAGCACGCAGAGCACCGAAAAAGTCG
ATGGATTGTCCTGGGAAGGTGTAGAAGCCGGGGCACCGACGGTGGAGGAGAAGGCAGCAGCCATCTCTGTGCTGCTTGCTCGACCTTGCTAGCAGCGGTG
GATGCGCGGCTGTGCTGGTGATCAGTGATGAATGACC
page-top