Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7341  (registered. 2012)
Contig Information
Length 1223 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig7341
CCCCTCCCTCCTTCTCGCTCCTCGCCATGGCCGATTCCCACAGCCCCTCCCTCCTGCTCGCTCCTCGCCATGGCCTCCGCCCTTGGAGCCTCGCCATGGC
CTCCTACTCCCCCTCCACCACCGTACGTGCACACAGACGGCGGTGCCGGAGAAGAGCAGCTCCAGTCATGGTGGGGTGCAGCTGCGCCGGGGATGAAGGA
GGTCCGCCGCCTGTCTTTGTCTCCTTGCTGCGTCCTTTGTTGCCAATCCTCCCCTCTCCATTAGCCCCTAGCAGCGCAACAGTCTGGGACAAGGGGAAGG
AGCAGGTCAACCCGACTCCATCTCTCTGCACGAGGACTAGAGGAGCAGGTGGCGAGGGAAGCCGGCACGGCCAGCGGCGGCGCTGCACAGGGACGTCCGC
CTCGGGTTTTCCGTCCTGTCTCCCGATCCCCTTCCCTTTAAGTGTTTTTCTTTTTCCTCTTGGCCCGATCTGCTCACATGTTTGGGGTTTCGTGCTGTAG
GGATAAGATCTGGTGCGGGAGGTGTGGTATACTGCATAGGTGTATAATCTTGGCTATGATCTATTCTGGAGAATGTCGATGTTAAAGCATTTGGTTTTGA
TGGATCATATTATTGGTTCTCTGTTCAACTGAAGATGTCTTCAGATAGGACTAAGGTGAGTTGAGTTGTGGCTTGGTTGGAGATGTTGATGCTGTTTGAG
ACGCCCGCTGGATTCACCCTTTTCAAGGTTATGAACATGGGCAAGCTCGACAAGGTCCAGGGGTATATGGACCACAAATGATGTGATATACTTCGTTATT
TCAACATGAGTACGGCTCAGCAGGAAGGTCAACCGTGAGGAGGCGCAACATAGCGTGGCCTCAGCCAATTAGATCTGAGGATGAAGAGAAGAAGAATTTA
TCTAAAAGGGTGAACAAGATCAAGGGGGTGAGAGGCGGATAACAATACGAGAAGGAGCATGCCATCGAGGAATGCAAGCAGCGGCACTCCTCCGCAATGG
GGTATGGCTACAGGGGAGGGGACACGGCCAACTGACAGGAAGAAGGAGCAGGTCGTCGATGTAGCATATGGGCCTTTCAGATGCATGTGCCTCCATATGC
GCCAGAAGTTATTCTTTTCATGCACATGCAAAATAAAATTTTAATAGAAACACTGCTAAAAGACCCTCCTTAGCAGGTTTATAGATGTCGTAAAAATATA
TTCTTTTTCATACAAAAAAAAAA
page-top