Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19975  (registered. 2003)
Contig Information
Length 1574 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit hypothetical protein LOC_Os03g57620 [Oryza sativa (japonica cultivar-group)]
Score 391
Evalue 1.26007e-35
Total Hit Count 84
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19975
CGGCGGCTTCTCCATCAATATCCTGCCCCGTCCCCCACCCCCACCCCCACCCCCACGACACACGCACCAACAGATCAGCCGTCGAAACTTCAGATCATGA
CTCCGCCCTCGCCTTCCCTTTTCCTCCTGGATCCCTTCGTGGGCACGTATCTCCCCGGCGGCGAAACAGCCGACAACAAGAAGACTTTGCTGTCCTCTGG
AGCCAAGAGGGCGTTCGGGTTCCCTGCGGACCTCGATTGCGATGCGCTCATGCGGGGCCTGGCGCTAGAAGCAGACCTTGCTGGTGCGCCAGATCTGTCC
CGCCTGACCCTCCGAGGCGTCCGCCCGTTCTCCACTTGTATCCATGCCGTCGACAAGAACCTGATTATCATGATAACTTCCTTTCCTCAAGTTTACCCCC
GGGGTATCTATCTCATCTACAACGCAATTGACAGATCGCTCCTCATGATCCCGTCTGCGCCCAGCACACCCCCTTCCGTCCTTACGTCCCGTGTTCTTGT
GGCGCGCCGCCGGGACGACGACATCAGCTCCTACGCCCTGGTCTTTCCCGGGACCGTCTACGACATAGGCTGTCCTGGACGGCAGCCTGTTCTCTTCGTG
TCGGGATCCTCATCTAAGTCTCAGTGGGAGATTGCGAAGTTCACTAATTTCCCCGACCATCTGCTCGCTGAGAAAAGCTCTTTCCTTGCCGAAGATGTGT
TCTCCCACCGTGGCCGTGGTTACTGGGTGGATCTCTTGCTTGGTGGCATGTACTGTGACTGCGGTGATGTGTTCTCCAGCCAGCGTTACATGGACGCCCA
CTCCTTAGACCTCCCTGTGGGGTGCGAGAGATACTTAGGCTGTAGAGATTACATACCAGAGCCGAGGGCCTTTCGAGCTGTGGGCTGTGTTGGGGACTCC
ATCAAGTTTGTCTCCATCACCGGCTTCCTTGAGCGTGTGGATCTTGTGGATGACCGCATGGTGAGGGTCTGGAGACTCAAGGAAGATATGAGTTGGGATG
TAGACTACGAGCTCAAGCTGGGGAGCCTGCGTGAAGAGGGGGCTTTCAAAGGGAACCACCTGCCGACCTCCATGGCACCCATGTACCCCTTCCTCAACAT
ACAGGAAGACCGTGTCATATACTTTGCACTGGGTGAGTACATCTACCAGGACCCGGAGTTCTGCTTTCCATCCACGCCAAGCTTTTGGGTCCGTGTTGAT
ATGAGCAGCAAGACTTTCAACTGCACACCTCTCTCTCTGACGGATGCCAGCATTGGCTGTCTTCTTGCTCTCTCCGGCAATGCTGAGGGCAAGCTTGCTT
GGACTTCCCAGCCAAGCCAACTTCTGAAGCCATGTCCTGTTAGTTAGGGAGGGGCAATATGGAAGCACCAGATCAAGTATCAGGAATCATGAAGTTTGGT
TATCTTTTTATTTTGCCTATTTTTATTAACAAGATGTTTATCTGGCTCAAGTCAATCCCTTGTTTATTTGCTTTTGTTGGAGTGAGAAACTGTTGTGTTT
GGCTGCAACTTGTCCCATGAGATTACTGTTTGATGACATTCTTGTGAGATCCTTATTCTCGTGCTGTATATCAT
page-top