Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7339  (registered. 2012)
Contig Information
Length 1342 bp
Clones alternative view 59 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 1
Wh_r Root 1
Wh_yd Spikelet at late flowering 4
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 3
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_CA 1
WH_SP 4
WH_XA Root 3
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 9
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125559175|gb|EAZ04711.1|| hypothetical protein OsI_26872 [Oryza sativa Indica Group]
Score 543
Evalue 2.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7339
CTCCCGCCGCCACCACCCGTGCCTCCTCTTCCTCCTCGCTCTCTCGCGCACGGGGCTCGCGTCCGAAACCCTAACCTCCCACCATGGCGGCTGAAGGCGG
TGGCGTCCGGGCGCTGTCCCAGCGCGAGCAGGACATCCAGATGATGCTCGCCGCCGACGTCCACCTCGGCACCAAGAACTGCGACTTCCAGATGGAGCGC
TACGTCTACAAGCGCCGCACTGACGGCATTTACATCATCAACCTTGGCAAGACCTGGGAGAAGCTTCAGATGGCCGCAAGGGTCATTGTTGCGATTGAAA
ATCCTCAGGACATCATTGTGCAATCTGCTAGGCCCTATGGACAGAGGGCTGTCCTCAAGTTTGCCCAGTACACTGGTGCTAACGCCATTGCTGGCAGGCA
CACTCCTGGTACATTCACCAACCAGATGCAGACTTCATTCAGTGAGCCACGCCTTCTTATCCTGACCGACCCCAGGACTGATCACCAGCCTATCAAGGAG
TCTGCACTTGGAAACATCCCCACCATTGCCTTCTGTGACACTGACTCTCCTATGCGTTACGTTGATATTGGCATTCCTGCTAACAACAAGGGGAAGCAGA
GCATTGGTTGCCTATTTTGGCTGCTCGCCAGGATGGTTCTGCAGATGCGTGGTACCATTCTCCCAGGACACAAGTGGGAAATCATGGTTGATCTGTTCTT
CTACAGGGACCCAGAGGAAGCTAAGGAGCTTGAGGAAGATGAGGCTTTGGGTGCTCCTGAGTACGCTGCAGTTGCAGAGTACACTGCCCCAGCGGGAGAT
ACCTGGGGTGCTGAATGGCCAGGAGCTGCAGCTCCAGCTGCTGCCGTCGAAGCCCCGGCTGGGGCTGAGTGGACTGGTGCTCCAGCTCCTGCGGCCGATG
GATGGGATGCAGTTGCAGCACCTGCCCCTACTGGCTGGGAACAGGGCAGCGCTCCCGCACCCGCAGCAGCACCAGCTGCTACTCCGAACTGGGAGTGAAG
GACTTGACCCAAGGTTTATGCTACTCGGCACTGTGGAGTGAAGGAGTTCGGCCGTGGTTTACGGGTGAAGGCTGTGTTATTTGCCCCGTCAGTACTCTGT
TGGTAGACGCTGGTTAAGTAGATTTAATTTTTACAGTGCTGAGTTATGTTAGATGGAAATCGATTTTTGTCTTCTTGGCTCTGCAGGGGCTGGGAGTTAT
CACCCCAGCCTTCTGCTGCCTCTCATCGAATAGCTTTATTTGAAGTTCCATTTTGCCAGCAAGTGTATGGTCAGATTCTCTTGAAATGTTATAAAAGCCC
GGATCATGTGATACTCTAGATATGTCTACTTTATTTATGAGG
page-top