Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7337  (registered. 2012)
Contig Information
Length 1708 bp
Clones alternative view 123 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 11
Wh_V4816 Shoot grown under cold condition for 16days 3
Wh_VABA Shoot with ABA treatment 10
Wh_VHS Shoot with heat shock treatment 3
Wh_VWD Shoot grown with dessication 7
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 11
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 17
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23Ž 7
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 19
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XV Leaves, plant was grown at constant 23Ž 6
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115470621|ref|NP_001058909.1|| Os07g0152900 [Oryza sativa (japonica cultivar-group)]
Score 678
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7337
TTTTTTTTTTATAATAATAATCATTTTATTATTGCCTCTAGGGCATATTTCCAACAATTTGGGCTGTGCAACACAATTGCATTGATCGGTGCACCAGGCA
CGTATATATGATGTACAGAGGAGGGCCACAACTTCAACTATACAGATAAACTAGGAGGTGGGCCCAAGACACAATATACACGTACACAATATATTCAACA
TGTTCAACTAGTTAGTTTCTTGGAGATCAACTTGTTGGCGGCCGGTAGAGTAACTTGTTCGTTGGATAAATGCAAACTCGCCTTGCACGTAATGTACTTA
ATTCATTTTTTCTTTTGCGAGGAATAATGTATATGTATTTAATTCATTTATCATGTTTGATCGATCCATGCCATATCACAGCACTTTGAAGTTGGGAACA
CACACACAGATATGTGGCCGCCGGCGACGTGGACGCACGTGCCGACTTGATTTGGTTCCAAGTTACAAGCGGGACGGCATGACGCCGAATTTGTCGGCCT
CGGTGACGACGTGGTTGCGGGTGATGTCGGCCAGCGAGTTGCAGCCGCTGAGCGCCATGGTCAGCTCGAACTCGTCGCGCAGCATCTTGAGCACGTTGCT
CACCCCGGCCTCCCCGGCCACCGCCAGCGAGAACACCACCGGCCTTCCGATGAAGACGCCGGCGGCGCCGAGAGCGAGCGCCTTGAAGACGTCGGTGCCG
CGGCGCACACCGCCGTCCAGGAAGACGGGGATCTGCCCGCCAGCACCCTTCACGACCTCTTCCAGGGCGCTGATGGTCGCCGGGACGTAGTCCAGCTGCC
GGGCGCCGTGGTTGGACACGATGATTCCGGCCGCGCCGTTCTCCACGGCGAGCCTGCTGTCCTCTGCGGTGATCACTCCTTTCACCAGGATCGGCATCGT
GGTGATGGACTGCAGCCACTTCACATCCTTCCAGCTCAGTGTGCGGTCGATCTGACCGGCGACATATGAAGCTAGTCCTGAATCGTTAGCCTGGTCCATT
TTCCCGAGGTCCAAACCTTCAAAGTTCTTGAGTGTCAAATTTGGTGGCAAAACAAATCTGTTCTTGATATCAGCTTCCCTGCGGCCAAGTCGCGGGGTGT
CCACGGTGAGCGCTATCGCCTTGAATCCAGCCTTTTCCGCTCTCCTCACAAGCTGCTCGACCACCTTCCTGTCCTTGTACACATAGAGTTGGAAGAAACG
GATCCCTGGTCCGGTTGAGGCAACCTCCTCAACACTCGAAGTAGCCCAGGACGACAATGTCATTATAGTGCCTGCTGCTGATGCTGCGCGGGCAGTTGCA
TACTCTCCATCTGGGTGAGCCATCTTCTGCATGGCAGTGGGGGAAATCATGATGGGCATTGAGAGCTTGAACCCCAGGATAGTTGTTGTCATGTCGATTT
TGGATACATCGATGAGAATGCGCGGGCGGAACAGGATCCTGGCAAAGGCCTCTCTGTTCTCCTGGAGCGTCCACTCGTCCTCGGCGCCGGAGGCGTAGTA
GTCGTAGATCATCTTGGGAAGCTTCTGCTTGGCGATGGCCTGGTACTCTGTGACATTGGTGATCTCCATTTGTCTGTGCAAATCACCACCTTGTATGAGG
AGGCTGTGGCTGACTGTCCCCTCAAGGCTGAGGGGAAGGAAGGAAGGATGGAACTAGGGGTTGTGGTGGGGAAGGGGATGGATGCAATATAAGAGATGAG
GCGGCGAG
page-top