Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19929  (registered. 2003)
Contig Information
Length 1221 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 2
Wh_SHC Shoot grown with cold treatment 1
Homology (BLAST) Top Hit Os08g0299000 [Oryza sativa (japonica cultivar-group)] >gi|50508226|dbj|BAD31730.1| unknown protein [Oryza sativa Japonica Group] >gi|113623453|dbj|BAF23398.1| Os08g0299000 [Oryza sativa (japonica cultivar-group)] >gi|215678729|dbj|BAG95166.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215692469|dbj|BAG87889.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215708833|dbj|BAG94102.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1411
Evalue 4.74665e-154
Total Hit Count 378
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19929
ACAGTTTTGACCATCAAACATTTTCAGAATTTTGTAGAACCTTTATCATGGTTTTGAACGTTTTCTTTTTGCTGGAGCTTACTAGGAAGATACACACAAG
AACATCCAGAAATATATTGTTCTCTTGTTTCACAGAATCCTGGTGCCGCCAGAGCAGCTACTATGGGACTTCAACCAGAGCCTGCTATTATTACAAAGTT
CGACAGAAAGCTCCGGTGATTGCAAGCCAACAGCCATGCTACAGCACGTTACACCAGGGTGTACCCAGCAAACCACGTTTTGCTCAATCTTTACCTTCTT
CTCCAGGACTGTCCACCTTGGCCGCAGCAGATGCGTAGCTGACACTGCTGTCCCTCGTGCTCTTGCACTGGCTCGACTGCTCATAGCGAACAAACCCGAC
CTTAATCTTCGTCGAGCAGTGTTTCAACATATGAAGAAGGACGCTGATGGGATGGCGTCCACATATGGTGTTCTCGTACTCCTCGAGATACTGTTTGAAC
GCGTCGGGGTCACCAGTCTCTATGATCTCCATGCCCAAGCGGTCCAACGCCTCGATTGATTTGTGAATGGCACCATGCTTCTTGTCATAGTATGTATAAC
TAAACCGAGATCCCCAGTGGCAAAAGTCTGAGGAGACAGAAAAAAAGTTCTTTGGATCATCCACATATTTTGCAAGCAACTGCCCATACATGGCTTCATT
TTGGGAGTTGACAGCACCAACAAGGATAGGTACAACTTTTACATTATGTCCCTGAAATACTTTAGAAAGGTAAGGCAAATGCATTTCCATGCTATGTTCA
GCCTCATCGACATTAAGGTCCATAAATTCAAATTTTCCGGTAGCTTTGAGTTCCTCGATAACTTCCAGGTCTACTGGTAAATCCCCAATCGGGGTGCTAT
AAACAGTAGCTCTTGACAGAGCACATTTTGGAGTATAGTAGTGATGAGATGGGCCGAGCAGAAACACCCGAGAAATGTTAGTTGGATCAATGTTGCCAAA
AGCATAAGCTGCACATCGCCCTGAGTACGAATAGCCAGCATGGGGTGCAATTACGGCCCTAACATCAGGTGACTTCGTGAGAGCAGCTGCCGAAAGCCAA
CCATCAAGTTCCTCTTCCAGCTTGCTGGCGTTGTTGGTGTACCAGGAGCCGGCATGCGAAGCCCTTCTCACGCGCTCCATCGTCGTGCGGGACGGAAGGA
AGGAAGGGGATTCGATTGCGG
page-top