Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19870  (registered. 2003)
Contig Information
Length 1022 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VHS Shoot with heat shock treatment 4
Homology (BLAST) Top Hit Os06g0683200 [Oryza sativa (japonica cultivar-group)] >gi|52076649|dbj|BAD45549.1| putative 50S ribosomal protein L24, chloroplast precursor [Oryza sativa Japonica Group] >gi|52076895|dbj|BAD45908.1| putative 50S ribosomal protein L24, chloroplast precursor [Oryza sativa Japonica Group] >gi|113596427|dbj|BAF20301.1| Os06g0683200 [Oryza sativa (japonica cultivar-group)] >gi|215687383|dbj|BAG91948.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215765579|dbj|BAG87276.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218198769|gb|EEC81196.1| hypothetical protein OsI_24210 [Oryza sativa Indica Group]
Score 790
Evalue 3.72928e-82
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19870
TTTTTTTTTTGACAGAAATGTAAAACGAAGGCCTTCTTGTTGGACCAAGCGTTGCAAAAATGGTGACAACTTTGTAGTAGTAGTAGTAATTTACAAAAGA
GGCTCTGAAGCTAGAAAAAAACTGACAGTACAAGCAGTGGCACCAGCCGAGTAAGCGTTTGGGCAGCAATAAGCGCAGCTAAGGTTGAGAGCATGCGCAG
CATTTCCATACTACGATGATGACTCAGAATCTCCTTCCTTGAACACCTTCACCCAGTTGTCAACGCTGTCGATTACTTCACCGGTCTTCTTCAGGTAGCG
GACCTTGGTGCCATCCTCGAGGATTTTGTGCCCAACCCTACTCGTCACGTTCTTCTCCTTTGAGTAGAGCATCATGTTCGAGCTATGAATGGGGCCTTCA
ATCATGACAATTTCACCCGGTTCATCCTCAGTGCCTTTCTTGTGCTTTGACTTCAAGTTCAGATCCTTCACTATCACAGTGCTGTTGTGCTTATAAAGCC
GTACGACTTCCCCAACTTTACCTTTCTCACGGCCTGCGATGACCTGCACCGTGTCGCCGACCCTAACATGCATCTTGTGCAGCATAGGAAGACTGTTTGG
CTTACACTTCTTCCGTTCCCATCGCTTAAGCCTCATTTCAATTGGGCTTGTCTTGGCCATGAATCTGACCCCAGACGGCGCGGCGGAGAAGGTGGCGGCG
AGCGGGTTGCCCCAGAATGCGCTGGTGCTCGCGGCCGAGGTCACCTGCTTCTTGAGCTTCTTCCCAAGGAAGTTGGTCGGCGTAGAAGCCGGGGCACCGA
CGGTGGAGGAGAAGGCAGCAGCCATCTCGGTGCTGCTTGGTCGACCTTGCTAGCAACGGTGGATGCGCGGCTGTGCTGGTGATCGGTGATGGCACCGTGT
AGAGACCGATCGAGGGCATGCATGTGTGTTTCTTTGATTNGTACATGAGGATGGATGAACTAAGAGAGGTCGATTTCCCTCAAGGATTCATGTGTGCACA
ATGATTAAGAAATCTTAGTAAT
page-top