Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7328  (registered. 2012)
Contig Information
Length 817 bp
Clones alternative view 34 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 1
Wh_V483 Shoot grown under cold condition for 3days 1
Wh_VWD Shoot grown with dessication 5
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 12
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 1
WH_XV Leaves, plant was grown at constant 23 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|1657859|gb|AAB18209.1|| chlorophyll a/b-binding protein WCAB precursor [Triticum aestivum]
Score 522
Evalue 2.00E-146
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7328
ATTTGCTCAGCCTTCCAATGGCAACCACCACCATGTCCCTCTCCTCCTCGACCTTTGCCAGCAAGGCGGTGAAGAACGTGTCGTCATCGGCTCTCTTCGG
CGAGGCCCGCGTCACCATGCGCAAAACTGCAGCGAAGGCAAAGCAGGTTTCCTCTGGCAGCCCATGGTACGGTGCCGACCGTGTGTTGTACCTCGGCCCA
CTCTCCGGTGAGCCCCCGAGCTACCTCACCGGTGAGTTCCCTGGCGATTATGGTTGGGACACTGCCGGACTTTCGGCTGACCCGGAGACCTTCTCCAAGA
ACCGGGAGCTGGAGGTGATCCACTGTCGTTGGGCCATGCTTGGGGCACTTGGTTGCGTCTTCCCTGAGTTGCTCGCCCGCAACGGCGTCAAGTTTGGCGA
GGCCGTTTGGTTCAAGGCCGGCTCCCAGATCTTTAGTGAGGGTGGTCTCGACTACCTCGGCAACCCCAGCCTTGTGCACGCGCAAAGCATCCTAGCTATT
TGGGCATGCCAAGTCGTGCTCATGGGTGCTGTCGAGGGGTACCGGGTTGCCGGCGGCCCACTTGGCGAGATCGTCGACCCACTATATCCAGGAGGCAGCT
TTGACCCTCTCGGCCTAGCCGATGACCCCGAGGCATTCGCCGAGCTCAAGGTGAAGGAGATCAAGAACGGTCGCCTCGCCATGTTCTCAATGTTCGGCTT
CTTTGTCCAAGCTATCGTCACGGGCAAGGGACCACTTGAGAACCTCGCTGACCACATCGCNNNNNCCGTCAACAACAACGCCTGGGCATTCGCCACCAAC
TTTGTCCCCGGCAAGTA
page-top