Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19815  (registered. 2003)
Contig Information
Length 950 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_VSCB Liquid cultured tissue 4
Wh_VWD Shoot grown with dessication 1
Homology (BLAST) Top Hit RNA-binding protein cabeza [Zea mays] >gi|195622928|gb|ACG33294.1| RNA-binding protein cabeza [Zea mays]
Score 639
Evalue 1.06414e-64
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19815
CTTCTGAGCAAGCATACGTCTTTGGGTTACATAACTCGAACTGCAAACTTGATGAAAGGAACGGAAATAATAAAACGGTAAACATAGCTAGTCATCATCG
ATCAGACGGACAGACGGACGGTCCCAAATGGGAAATGACAACCAAATCTAAAACGGGAAGAGACAAAACTAGTAAGCATGCACTCGAGGAGGATTTCTTT
GCATTCTACTTTCTTCTTCTTCTTCTTATGATGATGATGTCGACTGCGGGACACGGACACCCTTTGCTGCTTCTGCTCATCGCCGCGGCCTTCCTACACC
TCAGTGCAAGAAATTTTCGTATGGCGTGGCGCTACCGGAGTCCCTCGGTGCGTTGCACCTGAAGCACTCCTGCCTGCTGGCGAAGTTGTGCTCGTTGCAT
CCAGACCTGGTGCAAATCCAGTCGCCAGACTTCCAGCCAGGGCGGCTGGCACGACCACCGGCCGCGCCGGCTCCCATGCCGCCACCCATGCCACCGACAG
CGCCGAAGCCGAAGCCCCTTGAGCGTGACATGTCACCATCAAAGCCACCAGCGCCACCATTGACGGCAGCTTCCTCCTTGAAGGCAGCACACTTGAAGCA
GCTGGAGCGGCTGGCGAAGTTGTGCGCCCCGCAGGTGCAGTACCAGTCGCCCGGGCGGACGTCAGAGCCGGCACCAAAGCCGGTACCAAAGGAGGAACCA
CCCCCGCCACGGCCGCCAAAGTTGGCGTAGTCACCACCAAGAGCGCCACCGACGCTGCCACGGTCAGCGGCACTGCGTGGCTCGCCGCAGCGCTGGCATA
GGTCCCGGCGACTGAAGTTGAGGTGCTGGCACGACCTGCAGTCCCAGTCGCCTGGCTTCCTGTTCATCTTGCCTCTTTATGTTGGGATTTCTTTCGGGTT
TTGGGATCTGTGTGCTCGCGGCGGCACGGCACGGCACCGACGTCGAGGCG
page-top