Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19780  (registered. 2003)
Contig Information
Length 1105 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit Os03g0261500 [Oryza sativa (japonica cultivar-group)] >gi|108707289|gb|ABF95084.1| DnaJ domain containing protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|113548092|dbj|BAF11535.1| Os03g0261500 [Oryza sativa (japonica cultivar-group)] >gi|215694279|dbj|BAG89272.1| unnamed protein product [Oryza sativa Japonica Group]
Score 943
Evalue 7.58646e-100
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19780
TTTTTTTTTTATTCCAAGATCCACTTCAGCGTTTCTTTTCCAACAGAAAGTTTCTTTTTCAAGAAGGCATTCTACACAGGTACATTAGTCCAATACCACT
CTATGTAGATGATATGCGGCCATTTTTGCTCACAGTTATCTGCCATGTTCCACTGACTACACTGGGAACATACAAGCCATAACTCAAGTTTATAGCCTGA
AAGATAAACTTGACAGGCTGTGGCTTGGATCAGGTCGCGGCAAGAATGGCCGCCAGATTGGTCTTCGAGTGCAGATGAATACGACACCTTTTAACCACGC
TTTACTGGCCTCTGAACATAAGATTTGTTCGGGTCTTCAGTCTTGAGCCTTGGAGGTTTGAGCTCTCCTTTCCGTGCCTTCTTTCCTGTCTTCATGAAAT
CCCTCCAGCTAGAGACTCGCTGGTCTCTCGTCTCCTCCCACTTCTCTTCATGCTCTCTCTTCCTCTTCCACATTTCTTTTGTTTCCTCCTCGTCCTTCTT
CAGTCTTCCTTCTTCCTCTGATATCCTCATCTGCATTTTCCTCCGACGCCATTCTTTGTCTGTCAAAATCTCACGAACTTTAATTATTAGCTGCTTCTGA
AATTCGTCCGATCTTTCAAACTGCTCTTCATACTTTCCCTCATCTACTTGGGATTTTATCTTAGATGCACTGTCTTTCCTCAACTCTTTTTTCCTTTTTG
CCCTCAGTTCTTCTTTTGCAGAAGTGACTTGATCAAGAATGTACCCTCTTTCCTGTGGATCAAGTAGGAGCTGCTGTGCTTTTGCCAGGGCTCCAAAAGC
TTCTTGTGCTTGTGGATGCTTGCACTTGTCAGGATGGACCAACAGTGACAACTTCCTATATTGCTTCTTCACCTCATCCACAGAAGAATCAAAAGACAGC
TTAAGATGCTCAAAAGGGTTTAACTTGAAGCAACCAAGTATCCTGACGACTTCGTTGTCGCGCTCGGCCTCGCTGACCTCGGCCAGGAAGCTTTTGAGGA
GCTGGTCGTCGTCGGCCTCCGACGACCCCATGGGTGTACGGGGAAGGAGAGGGAGGTCGCGGCTCGGGTGGGCTCCGGCTCTGGGAGCAAGACGAGAGCG
CGTGC
page-top