Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19765  (registered. 2003)
Contig Information
Length 1093 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_PCDAM Anther at meiosis 7
Homology (BLAST) Top Hit hypothetical protein SNOG_00143 [Phaeosphaeria nodorum SN15] >gi|160700948|gb|EAT91638.2| hypothetical protein SNOG_00143 [Phaeosphaeria nodorum SN15]
Score 85
Evalue 2.30801
Total Hit Count 2
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19765
ATAACTTGATCATAAACCCACAATTCATCGTGATCTTGACAAACACACCGCAAAAAGAGATTACATCGAATAGATCTCCACAAGAAAGGGGGAAAACATT
GTATTGAGATCCAAAAAGAGAGAAGAAGTCATCTAGCTAATAACTATGCACCCGTAGGTTTGTGGTAAACTACTCACAACTCATCGGAGGGGCAAGGATA
TTGATGTAGAGGCCCTCCATGATCGATTACCCCTCCGGCGGAGTGCCGGCGAAGGCTCCAAGAAGGCATCTCGCGGATACAGACTGTTACGACGGTGGAA
ATTGTGTTTCGTTGTGCTCCTGGATGTTTTCGGGGTACGTAGGTATATATAGGAGGAAAAACTACGTCGGTGGCCGCCCGAGAGGCCTACGAGATAGGGG
GGCGCCCTCCTATCTCGTGGCCGCCTCGGCTGCTTCTTGGCTTGCACTCCAAGTCCTCCGGATCACGTTCGTTCCAAAAATCACGCTCCCGAAGGTTTCA
TTCCGTTTGGGCTCCGTTTGATATTCCTTTTCTTCAAAATACTGAAATAGGCAAAAAAACAGCAATACGGGCTGGGCCTCCAGTTAGTAGGTTAGTCCCA
AAAATGATATAAATGTGTAAAATAAAGCCCATAAACATCCAAAAGGGGTAATATAATAGCATGAAACAATCAAAAATTATAGATACGTTGGAAACATATC
AGCGTGTCAGCATTACTGATCCAGGGATGACACTAAAGCACAGAGATCAGACTGTTTGAGGTCTGGTCGCTACATTACTCCCGCTGTCGCCGCTGCTTTG
CTCATTTTTCATATGGATGGCAAGGATGCATGAAGACCATCTGTACACATATTCACGTATATGTCTTGCCCTAGAGGCTAGATCCGCCTAATCACTGTGG
CCACCGCCACTGCTTTGTTGATGTTGTCATCTAGATGCTGAGGATGCATGAGGACCAGAAAAAACTCTCTGTATTTGTCGCTATTGTTAGGTCTTTGTTT
TTCCTAAAAATCTCCTCTCTAATTGTCGATGTTATTAGGCCCCTGTTTTCCTTATGTTGTTGCCTCAACCTTAGCTGCTACAGGTCCAAGATG
page-top