Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19754  (registered. 2003)
Contig Information
Length 1277 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_RDr Root of dessiccated seed 1
Wh_VHS Shoot with heat shock treatment 4
Wh_VSCB Liquid cultured tissue 1
Homology (BLAST) Top Hit hypothetical protein OsJ_009386 [Oryza sativa (japonica cultivar-group)]
Score 1234
Evalue 1.68554e-133
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19754
TGTAACATATACATACAATAAATCATCCAACAATGGTACATACACAATCTACTTTTTTTGTGGAACATACACAATCTACCAGACAACTGTGTGCCGGCTA
CCATGGCCTAGCATAAGCTCCAGGTATCGCATAAAGATGAGAGAGAGAAAAATGAAACTACCAAGGAACATAAAGATCCCCTTTAAGATTCAGGACGTGG
TTCAGCAGCTACAGATGGTCAGTAGACGGTAGCAGCAGCACGGTTTGTGCCTGTATTACAACAGGATGCCACGACGAGTATTTCAGTTATACCCATCAAA
TCTGAATGGTGTGCGCAGCGGAGGGTTGACAGCTGGGCGCCAAGAAGCAAGCAGCCACAGTCCTTTGGATTATGGAACTCACATTCGCTGATTAGGTTCC
ACCCTTGGATCTATGTGCCGAAGACAAAGCCATGAAAGAACCTAAACAAGCTTCTTCCATATTCAGGAATCTCACTGCCATGCAGAAGATACAACCAGCT
TTCTGTTCTTCCATCCAAGATAAATGACACCATCTTTCTCCTCTAGCTTGTAGTAACTGTTGTAATCATTTAACAGTGTTCTGATAGTATTGTTCACCAA
TGCACTTAGGGGGTATGGTCTAAAGCCAGCCATTGCAAACCTAGACCGCCACTTTCCAAATGGTTCGTGCCTCTCCACTCTTTCTGCACCTTCACATGCA
ATTAAATTGACAATATCTCTTGCAACACAGTGCTGCTCAGTGCTCATCCTCACCTTGTCATCCCTAGGGCAAGCAACATCTATTGCCTCGAACATGGCTG
TGTAGTAGTCAAGGGTCTCCATGTATCTACTGAAGAATGGGGCAGTGTTTGTGTTAGCCTCCTGCTCTACAAGAGTTACCACGCTAGGAGAAAGGCTCTT
AACCATTCTCAATATCCTATCCCGGTGGTTTTCTATGCAGACACTTTCATCAGGAGTATGATGCAGCTGATACGCAAAGTTGACAGCAATAGCCTCTCCC
TTTCTTATATCAAGATGTTCAAGTGTAACCTCATGACTAGCTGCATGTACAGCATTGAACTCAAAGGGCAGACGACATGACTGGGCAACGCTGTATAACT
TACGCCCAACTATATCCAGTCCACCACCTCGGGCATAAGCCGAATCTGAGTCATCTATACCAGTAATTCTTAAGCATGGTGGTCCGCTAGCCCTCGCAGC
AAGGGCCTGTATCATAGTTACCCACTGGCTCCCTTGAGCGATTTGGAAATCGATAATGTGAATAAAGTTCTCACCCT
page-top