Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7310  (registered. 2012)
Contig Information
Length 1232 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 2
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VWD Shoot grown with dessication 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 5
WH_XN Leaves, plant was grown at constant 23Ž 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115457532|ref|NP_001052366.1|| Os04g0281900 [Oryza sativa (japonica cultivar-group)]
Score 352
Evalue 7.00E-95
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7310
TCCTTAAATTAGGAAGCTCATCGTAGTTACATAGATCACTTGGGTGCCTGCAACGGAACTAGGTTCGCATTTTTGGAACGCATCAATGAATCCACCACAG
CCTCACAGCAGAAGATTCAAAGCTAGTACGGTATATATAGAATAAAGTAAAAAGAGAGGCAGATGCACTATATGTAGCTTGAAATTAACTATGAGCCCTT
ACAGATTATTTCGTTCGCCTACACACACAGCGATACTACTACGTACGTACGTGTTTTGAGTTTTGACCCGTCATCGAGTAGCCAAGGCACAGCAGCTAGG
GATCCTCTCGGCTCAGCGCGGGAAGGCAGCGATCTCGACGCCCTTGTTGCCGAGCGAGGGCATGGGTGCGTCGTAGGCGCTGAAGAGGCGGTAGGACGAG
ATGAGGGAGAGGAGGATGTAGCAGACGACGGAGCCGAAGGTGATGGCCACCGACGTCCGGGCCTGCCTGCAGAAGCCGCCGAACACGCCGCACGCCTCGC
TCCACGTCACCTCCTTGTCGCCGTTGTACGCCAGGTAGAGTAGCTCTGCCGACGCCGCGCCGGCCGCCAGGATCAGGTACGTGAACACCTGATCTAGGAG
GAAGACGATCCAGGAGCGGGACAGGGTCGCCGGCCGCGGCACGGCAGTGTAGAACGCGGAGACCAGGGAGTAGGCCGCGCACAGCCCGTTGGCATAAACC
AGGTACTTGAATCCGCCGAGGTCGGAGTAGGAGACGGTGCCGTACTCGTTGGTCTGCGTGTCGCGGAGCATGACGGCCATGGCGGCGACGCAGAGCCCCA
GAGGCGCGGCGCGCAGCAGCGTCTCCAACGGACGGACACGCGCCTCCGTGGCTGACAGGTCCCCTGCGATCAGCCCGTCCTCTCCTCCGCCGGTCGCCGG
CGCCGAAATCACCTTCTCGTCCGCCATCTTCGACATCTCGACCAGCAGTCAGGGGCCAAAAACCAGCGTCGACGAAGAAAAGAGCTCGACTTCCTCTCAC
TCCCGGTCCCGGTCCCTCTCCTCTGCTTGCTTGCTTGCTTGCTTGAAAGAAAGGGGATCGGGACGAGGGGAGGCGCGCATTTAAGGCGTGGAGCTGGGGA
GGTTAGTTGGAGCGCAGCGCGGTGGCTTGAATGCGCGAGTTAATGGCGCGGTGGCAGTGCCGTATGGGCGAGCAGAGGGCAGTGACGAGTCGACTGGTCG
GCAGCTGCGTGTTGCGTCGCGTTTGCGAATTC
page-top