Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19635  (registered. 2003)
Contig Information
Length 1221 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_PCDAM Anther at meiosis 2
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit hypothetical protein OsJ_019218 [Oryza sativa (japonica cultivar-group)]
Score 264
Evalue 4.78905e-21
Total Hit Count 29
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19635
ATCCACTGGCAAGAGCACATTGCTTTACCAAACAAAATCACCAACAAAGCACATGGGTCACTTTCGTTTTGCCAGCTTACTCCCGCAAAACTTGGGTTCA
CCTACACCATAAACACGGGTTCTGCACAGGATCTTCACACCAGCTTATCCTCCACCCAGACGAGGCTTCTACATCAGCAAGCCAAACACTCAAGACACAT
AGTACTGACTCAGCATCACAGGTACCAAAAACGAACGCAGCACAAGAATGGCATACAGCAAAGCAAGCACTAGGCCCCATCGACTCTACATCTATGCCTG
CACACGTTTTGCCGGTACGATGTATTTGCCCCTCGCTCCATGGCCATCTGCTGCGTTGCGCATCCTGAATTGCCACCTCACCGCAGCCTCTTCCGTCTCC
AGCCAATCTTCATCGCGCACAACAATAAACTCATTAAATTCTTCTTCTGATATAGGCTTCCTGCACCGAACATGGGGCTTGGCTTCACACTTTTTGTACT
CCGCACCAGTGGGATGCTTCACATCATCACCGCATTCACAGCACTCACCATCATCTTCGGATGAAACCACACAAATGCAACTAAGCGTGTATTCCTCAAA
TTCACCATCTGTTGTGCAGGTCATTTCAATGAAGAGAAGATCTTCGATGGCATTAGGTCCTCTTTCTACAAGCACATTTAAATGTGAGAAGGACCTGCAT
TCATGCTGAGAACCTTTTCTTGGGAAGTGAGCTTTGTAACTCACAACTTTCTTGATTTCATATGCAAGATCCTCCAAAAGATGGTCCTCATTGTGCTTGT
CCAGTAAAGCTTTAACTACTTCCCGAGTGGGGTTATAGTTCATCATTACATCCAAAGCTTCTTTCGAGTTCTTCCTTGTGCCATTACGCCAATATAGTGT
ATGCCAAACATACCTGTCCTCTTTGGAAAGCCCACCCAAGTACTTGAATTTACACAGATTAATGTGATAGGAGTCTATAGCATCCTGAGCTTCTTGTAAG
CTCTTAAACGGACCACCTCGATGAGGATATGTGTGGAAGAGTCCACCAGCATCAACCCTCAGAAAATACTTAATTAGTAATCCTCTTGGCATCAATGCCG
AAACAGGTGGAAAGTGGTTTGGCGATGGTGGGGCCTCAATACGCACTGCCTGCTCAGTGTCCTCACAGGGTGGAAGCTGTGGCCGATCTGTAGGAGCAGC
CTTCCACGGTCACATTCACAT
page-top