Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19620  (registered. 2003)
Contig Information
Length 666 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_OKCS Seed DPA5 4
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit hypothetical protein OsI_08036 [Oryza sativa Indica Group]
Score 529
Evalue 3.15206e-52
Total Hit Count 110
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19620
CTCGCCCTCTCGCTCTCGCGTACTCGGCAAACCAGGGACGGCGACCGCTCTTCACCGCTGCCCCCCTTCTCCTCTCGGGCATCGGCAGATCTGCGCGGGC
CACTATCCTCTCCTTCCCCACAGTCCTTCCTAGCCATGGCTGGGAGGCACACCATTATTCTGATGCAACCATCCCAAAACAGGAGCTCCAGGACGTTCAT
GGATTATAATTCAATTAACCATGCATTGGATGGAATCTGTGGTCTCTATGAAAGGAAAATCAGGGATATCAACCCAATGATCCCGAACATAACCTATGAC
ATCACTGATCTGTACAACTTCATCGACGGCCTAGCTGACATCAGTGCGCTAGTCTATGATCACGAAATCCATGCGTTTCTGCCATATGACCGGCAGTGGA
TAAAGCAGAAGCTGTTTCAGCACCTTAAGAAGCTGGCTCAAAGATAGTGACTGGTGCGTGGTGTTTGGTTCAGTGTGTCGTCACCGGCAGGCATGTGTGA
TAATTTGTGTCCGATTAGTCCACCAGAAAGGTTTTTCTTGTACAATGATGAGAATTTCACATGGCATGCTTATATTCTGGGTGTGAAACTCATAGCTTGA
TGGTGGTTTGCCTCCGGCGCCCTATATATATGAGATGAACATATATTTGTTGTTTTAAAAAAAAAA
page-top