Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19615  (registered. 2003)
Contig Information
Length 774 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit RecName: Full=Xylose isomerase >gi|1296809|emb|CAA64545.1| xylose isomerase [Hordeum vulgare subsp. vulgare]
Score 956
Evalue 1.31107e-101
Total Hit Count 354
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19615
CTCTCCCTAATCCCTATCCGGCCCGCTTAACCATCCCCGCACGGATCGCGGAGCTGGTTGCCTCCCACTTCTCCGGCGGCCGCCGCGTTGCAGAGACGTT
TCAGTATGAGGAAGGGCGCGGAGCTCTTGGCCCTGCTGGTGGCGTCGTCCCTCTGCCTGTCTGCTGCGATCGCCGCCCAGGAAACCTGCCCGGCCGACAT
TGACGCCAAGTGCGGCGATGCCGCTTCCGATGGTTGGGAGGGCGAGTTCTTCCCCGGCATTACCAAGATCAGATATGAGGGTCCAACCAGCAAGAAGCCG
CTTTCTTACAAGTGGTATAACGTGGAGGAAGTGATTCTTGGAAAGAAAATGAAAGACTGGCTGCGGTTCAGCGTGGCGTTTTGGCACACTTTCCGGGGTA
CTGGAGGAGACCCTTTTGGTGCGGCTACGAAGAACTGGCCTTGGGAGGATGGCACCAATTCCTTGGCCATGGCTAAGAGAAGAATGAAAGCTCACTTCGA
GTTCATGGAGAAGCTTGGAGTTGAGAGGTGGTGCTTCCACGACAGGGACATCGCCCCTGATGGCAAAACACTCGCGGAAACAAATGCTAACTTGGATGAG
ATAGTTGAGCTGGCAAAGCAACTCCAGAGTGAGACCAATATAAAGCCATTGTGGGGGACTGCACAGCTTTTCATGCATCCACGTTACATGCACGGAGCTG
CTACTAGCCCAGAGGTCAAGGGTGTATGCTTATGCTGCTGCTCAAGTGAAGAAAGCTTTGGAGGTTACTCACTA
page-top