Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7294  (registered. 2012)
Contig Information
Length 1064 bp
Clones alternative view 152 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_dL Crown of seedling 5
Wh_e Seed DPA10 3
Wh_f Spike at flowering date 11
Wh_h Spike at heading date 2
Wh_r Root 6
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 6
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 5
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 7
Wh_MS Seed DPA5 of DT3DL CS wheat 7
Wh_OKCS Seed DPA5 9
Wh_SHC Shoot grown with cold treatment 4
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VHS Shoot with heat shock treatment 3
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 3
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 6
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 8
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 4
WH_XA Root 9
WH_XB Root 12
WH_XC Root, treated at 50 microM Al for 6h 12
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115452901|ref|NP_001050051.1|| Os03g0337800 [Oryza sativa (japonica cultivar-group)]
Score 388
Evalue 7.00E-106
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7294
TATTCATGCCCAATATAGGGCATCTGCTGGAGCAAAAGCGTTTCAGGTGATGACAAATATTCTTTTTGTGATGTAAATCTACCTTTTGTGCGCCCAAGAT
CCATCACCTGTTCTGATGACTGAAGGCACCCAGGCACTATTACCATCACAAACACAGTAGGTACATAAATTTGCACGCACAGAATATGTAAAACTAGGTT
CGGTGAACCGAAATGTTTAAAGAAACTCTGCATAAGCAACATCCAACAGAACAAACACGATATGATATTTAAGGTATCTCATACGCGGCACACAGATATT
GCACAGAAAACAGTTCTGAACTTCAGATGCTCCAAAATCAGGCTAACCCTTCATGATACCAGAAAGCTAAAGCTTCATGTCAGACCTTCACTTCTTGGCC
TTGGCCTTCTTTGGTGCCGCTGCTGCTGGAGCTGGAGCTGCAGCCGCTGGTGCTGGTGCATGATCTCTGGGGCCCTGAGCCAATCTCTCCTCCCTCCTGG
CATGCTTCCTCTCCCTGCTTGCCTTGCTCTTGGCGCGCTTGGCCTCAAACTGATCAGAGAGGGTCTTCTCTCTTGCCTTCTCAGCCTTGGACTTGTGGAT
ACTCTCCATGAGGACCCTCTTGTTCTTGAACATGTTACCCTTGACCTTCAGGTACATGTCATGGTACATGTGCTTGTCGATCTTCTTGGCCTCACGGTAC
TTGCGCAGAAGGCGCCTCAGGACGCGCATCCTCCGCATCCACAGGATCTTGGTGGGGAGCCTAGCCTCCCTGGTACCCCTACGCTTACCATATCCAGAGT
GACGGCCCTTCTGCTTGGCCTCATGTGCCCTCCTTGCACGAGACCTGGAGTGGATCTTCTGAGGCTTCCTGATGATGAAACCATCCTTTACCAGCTTCCG
GATGTTCTGCCGGGAGTTGGCCATGGAGATCTCGTTGACCTCATTGGGGTCGAGCCAGACCTTGCCCTTGCCGCACTTGAGGACGCTCGAGGCCAGGCGC
TTCTGCAGCTTCAGCGACACCATCTTCGCCGCCGCTCTCCTCCTCCCTTACCTGCCCCTCGTGC
page-top