Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19413  (registered. 2003)
Contig Information
Length 1312 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_SHDr Shoot grown with dessication 4
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 553
Evalue 1.97473e-134
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19413
TTTCTTTCAGAGGTTTTTGATGGGCAGTTTATTCCCCCTTCTTAAATTACATACTATTCAAGCTTAATCAATATTAACTCTTACAGTACCAGCTAAATCA
TCATTCATGAGTACTTGCAGACTCAACATTGCAGAGCTAAGGCTAATAATAGGACTAAGCAGGCACATCAGCTGGATACTCTGCAGGATGCTTTTTGATG
GTATCCAGCAGCGACCGCTCTTGCTCGCGAAGGTTGGAAGGCATTTGATCATACACATCAGTGAAGAGCTCCGCAAGCCCGTGTTTTGGCATCCTCTCGG
CCACCTGAATGGCTTGCAGGAGCTCTTGCCGCACATTGTTCCTGAGTTCAGACTCTTGAGTGTCGCACCACCATCCATTCCCCTGAACCCATTTTCTGTA
CCTGGAGACGGGATCCCTCGCTGTTCGCCAATGCTCCATCTCATCGGGCCGGCCTGTACTTGGTTGAATCGTCGGATGTCGAGTGATGGCCGACTCGGTA
GGTCATCGCCTCGATTAAAATAGGCCTTCCTTCAGTTATAGCCATTTCCCGGGCGGTGTGGACTGCACTGTACACAGCAAGAGTATCGTTGCCGTCTACC
CTGATACTGCGTATTCCGTAGGCCTGACCGCGGGTGACAACTCCATCACTTCTGAACTGTTCCCGCGGTTGGGGTGCTGATTGCCCAGCCATTGTTGCGG
CAGAAGAAGATCACTGGCGCTTCCGTGACAGCAGCGAAGTTGAGCGCGGCATGGAAGTCTCCCTCGCTCGTGCCACCATCGCCGAAATACGTGATGGCAC
ATGCCTTCTTCTTGTCCATCTTGAGAGAATAGGCAGCACCAACAGCTTGAGGGAGCTGAGTGGCGATAGGCGATGAGACTGTGAAATAATTCAGACGGTT
TGATCCGTAATGTATTGGCATCTGCCTGCCTTTACCGTAATCCAGCTTGTTCCCAAACAACTGGTTTGCAAATTCTTGCAGTGTGAAGCCACGCCATAGA
AGAACACCGGGCTCCCTGTACTTCATTTGGCTCCAAAATTTCCGGCCAAGAAAAGAAAAGCAAGTAAAATCAATACTATTCAGCACTAACATTCTTTTTT
GGAGCAGATGATATGCACCTGAGGTAGTACAATGTCTTGAGCACTAAGCGCAGCAGCAGAGGCTATGTTGATTGCTTCTTCACCATTGGAAGTTAGATAA
AAGGAAATTCTTCCCTGCCTCTGAGCTTCATAGAAGATTGTGTCCATAATCTGGAGGGTGACCATGTTACTGTACATTTTCAGAGCCAACTCCTTACTGA
CCTCTTGGAATC
page-top