Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19333  (registered. 2003)
Contig Information
Length 1684 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_PCDAM Anther at meiosis 1
Wh_RDr Root of dessiccated seed 1
Wh_VWD Shoot grown with dessication 2
Homology (BLAST) Top Hit Os08g0242900 [Oryza sativa (japonica cultivar-group)] >gi|40253690|dbj|BAD05632.1| putative synovial sarcoma, X breakpoint 2 interacting protein [Oryza sativa Japonica Group] >gi|113623313|dbj|BAF23258.1| Os08g0242900 [Oryza sativa (japonica cultivar-group)]
Score 1721
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19333
GTCTCATTGCTCCTCCCCACCCATCCCACTCGTCAGATCTCTCTCTACCCCGCCTCCCCCTCCGGCCTCCGCCCATGTCGGTGTCATCGCGCTTCGAGCT
CCGGGCCTCGTCGAACCTTCACCAGCAGCCACCGCCTCCCGTCGGCATGAGCGGCGATGTGGGGACATTCGCCGACGCGGGGAACCTCGAGCACTGCGCC
AAGTACCTCAATCAGACGCTCGTTACCTTCGGTTTCCCGGCCTCGCTCGACCTATTTGCCACCGATCCGGTATCTATTGCAAGAACATGCAACTGCATGT
ATGCACTGCTGCAGCAGCGCCAGAGAGACATTGAATTCCGGGAATCGACCAATGATCTACGGCAACGTATGCAGTCTGATATTTCAAGACTGGAAGCCAA
GATCGAAAGGATGGATGCCCAATTGGCAGCAAAAGATCGAGAGTTGGCCACTTTGACCCGAACGGAGGCCAAAAACACCGCAGCTCTGAAAGCTCATATT
GAGAAGCTGCAGCAGGAACGTGACGAATTTCAAAAAATGGTTATTGGAAATCAGCAAGTACGCTCCCAACAAATTCATGAAACGAAGAAGAAAGAAAAGG
AATACATCAAATTGCAGGAGAAGCTAAACCAAGTATTGATGGAGAAGAAAAAGGAATCATCACGTTCAGGAATGGAAATAATGAACTTGTTGCAGAAAGA
GGGACGACAGCGCGGAACATGGACTGGAAAAAAGAATGACAATGACTACTACAAAATGATTGTTGATGCATATGAAGTGAAGAAGCAAGAACTAGTCCAG
GAGAATGCTGATTTGCGGGCACTGTTACGTTCGATGCAGATGGATATGCGTGAGTTCCTTAATGCTCCAACTGGATCATCACAGCCTGCTGTTGCTGGTA
ATGGAAGACAGGAGGCAGGGTCTCCCCAGTCCCCACTTGGGGGCAAGACGGATGTCTTTGACTTGCCCTTTCACATGGCCAGAGACCAGATAGAGGAGAG
TTTGCGCACTAAAATGGCTTCAGTAAAGGCACGAATGACGCAACTTCAAGATGCTCAAAAAGGTGCTGAAGTGACCTCGGAAGTTACCGAGCGTGAACTT
GAGCTTGAAGCTCAGTTAGTTGAAGCCAGAAGCATCATCCAAGAGCAGGCGTCCATCATGTCTAAGCACTTCTCCAAGTCTGATAAACCAAGGAGGTTAA
GTGGCCTGGATGCCGAGCGTGAGGCGATTCATTCTGCTTCTACAGATGTGTAAAGATATATTCATGGCGAATTTCTGTTCTGGAAGGCTGCAAGGCACAT
CATGTTGGTCTGTGATGGAGGTCTCTTGTGTTGTAACTGCTGTAGTATAACTGATAAACCTCTTCCCGCCATGGTAGCACTAGTGCCGCGGCAGCCTATG
TAGCATGATGTGCAGGAGCATCTCTCCTGCCGTTGCTAGCTGATAATCCCGTAGGTATGGCTGCCTAGCTACTGGTATTCCTCTCTGATGGAGCGGAGTC
TTATGCAGCCTGCTGTCTTCGGAATGTAATTGTGCCTCGTTTTAGTTCAATGATGTGGTTCATCTTGTGGCAAACTGTTATAGCTCGTTTGGCACCTCGG
CTTTCATTTCATTTGAAATGAAACGAAAACACATTCATCATAGGATATTTCTTTTGGTGGGAAGTTTTCAGTTTGGCTGCCAGA
page-top