Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19318  (registered. 2003)
Contig Information
Length 487 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Homology (BLAST) Top Hit cysteine-rich peptide [Digitaria ciliaris]
Score 161
Evalue 6.48444e-10
Total Hit Count 19
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19318
TTTTTTTTTTGATGCCAGGGAACCGGAATCTGATGCTAATTAAATTAAGATGCAGCACAAACCATAATCGATGTTTACAGTGATAGCCTTGTCCTGGGCA
TATAATATTACAGCAATATCTGATACAGTTCTCATCGAGCTAAGGCACTAGACACATATGCTTATTATGAAAGGCGACGGCGGAGGCCGGTGGGTCTCCG
CTGCGCCTTGCGGCCTCCGTCCATGTCGGGCACGGCAGCCTGGTCTAGTTGCAGCAGCAGCAGAGGCAGTCGAGGCAGCACTCGCAGGTCTCGTAGCAGC
AGAAGCAGCACAGCGCCGTGAACACGCATGCGTAGAGGCAGCCCTTCTCCTCGTGCCGCTTCTGCGCGTGCTCGTAGTAGGACATGCCTTGCGGCGGCGG
AGGGTTGTTGTACATCTCGCCGCCGGCAGGCCGGGCTCCTCTCCTCTCTCCGGCTAGTTTTTGATCTCTTCTACCTTGTCAAGTTGT
page-top