Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7271  (registered. 2012)
Contig Information
Length 950 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 2
Wh_VWD Shoot grown with dessication 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|222613098|gb|EEE51230.1|| hypothetical protein OsJ_32079 [Oryza sativa Japonica Group]
Score 365
Evalue 4.00E-99
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7271
GTACAGCACCACATGAGTATTTGCGGTGTTTGACTAGTTTAACGATGGCGATGCAAGAGACATACGCCAACAATGAAGATGCAGGAGACAGACTGCCAAC
ATCTGACATTTATTCAAGTCCTACCACATGGACATAACTATAGCTCAACGGGTCTCAAAATTGAGCAATGTTTGATGAACCTGTCAACGTAAACAAATGA
GGCAACAATATAGCCAGTAGACGTGGCAGCAGTATCTGCTGAAATACTCCCAAGTAGAGCAGGTAAACCGAAATAGCGAAGTATTCACTAATCAGAACAA
ATGTATGTGCCTGATACGTCTCTTCGGGTGTGCTTCGTCGAACACTATTTGTCGTTGACAAGTGGGCTGTAAACAGGGTACCACATCTTCCGAGCCACGT
AGTCCACCGTATCCGACTCTGACATGCTCCTGAGGTCCCGAGGATCCAAGTCAGGGCATCCCTCGGCCAGATCTTCATCAACAGCAGCACGGGCGACTGC
AGCGCCGACACGTGCGGTGATGTGCCTGATACTTGAAATTGAAGGAAAGAGGATTCCTTTTCGAATCGCATCATCTGTGATGTATGAAGCAAGGCACTCA
GCTGCAGCATGGAGCATGCCATCCGAGATATGCCGAGCACCTGACAGAAGGGCTCCTAAACCAATCCCAGGAAACAGATACATGTTGTTCGCTTGATTAG
CATAGCCTTTTCTACCATTGCTTAAAGTAACATTACTGAAAGGGCTTCCACTGGCAAATACTGCATTTTCTCCAACATGCTTGAATACATCTTCAGGCGT
ACATTCAGCTTTAGTTGTTGGGTTGGACATTGCAAAAATTGCAGGGCAGGGGGAGTCAGATTCTTTCATAGCCTTGAGAACCTCCTCATTAAATATCCCG
CCAACTCCAGATAGTCCTAAAAGGACATGAGGCTTCACTTTCTTGACCAC
page-top