Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19251  (registered. 2003)
Contig Information
Length 1777 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_SHDr Shoot grown with dessication 2
Homology (BLAST) Top Hit Pollen-specific protein SF3, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|125579493|gb|EAZ20639.1| hypothetical protein OsJ_034848 [Oryza sativa (japonica cultivar-group)]
Score 1011
Evalue 1.88364e-107
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19251
CCCGACCGCCGCCCGGTCGCCGCCACCACCACACTGGAGCTGCTGCCCGCCAAGGGGGCCAAGCGAGGGTTTTCGGACGAGGTCGTGCCGCCTGCGCCGA
TTTCCGCCGCCGGGAAAGGCAAGGAGGCGTCCGGGGATGAGAAGGACAAGAAGGTCGCCGCCCCGCCGCAGCCTGCTGCCAAGGCTCAGGTGGTGGGATG
GCCACCAGTCCGCAGCTACCGCAAGAACACGATGGCAACCACCACCAACCAGCTGAAGAGCAGCAAGGAGGATTCTGACACGAAGCAGGGGCAAGAGTTT
CTGTATGTCAAGGTCAGCATGGATGGTGCGCCTTACCTGAGGAAGGTTGACCTCAAGACATACAAGAACTATAAGGACATGGTTGTGGCGCTAGGGAAAA
TGTTCATTGGCTTCAGGACCGGGAAGGATGGTGCATCTGAGAACAGAAAGGATGGTGAATATGTGATGACTTACGAAGACAAGGATGGAGACTGGATGCT
GGTTGGTGACGTCCCATGGGAGATGTTCACCGAGGCTTGCCGGAGGATCAGGGTCATGAAAAGTTCAGATGTAGTTGGGCTTGGAGTTACAAGGGCAGGG
GTTAAGTCCAAGAATAAGAACTAAAACGGTCGCTGCCCACGGTTTGAAGACGAGGTCGCACATGCCGTCTGTACTACTGCATGGTTTTCCTATCCCACAA
GTAAAATCACCCGTTACTCTACCGTTTAAGATTTGCGACATCTCCTAGAGACTTATGCTCTATATTTTGTTGTGCCCACGTTGTTGTACGCGTGTTATTT
CCATCCGTGTAAATGGTTGGTAAGCAGTGCGAGAGCTACTGCTGTGTTTGATGACTCCTATGTATTTTGCCACTCTTGTCCTGAACCGGTCGTTCGTCGT
AAATGTGAAGGTTGCAAGACGCCAAGCCAGTCTTGTGTTGGAAGAACGCCTCACCATCCATCAGAGCAGCTCGGCTTGCAGATCGAGAGTGAGGGAGTGA
GAGGCAATGGCGACTTCGTTCCAGGGGACGACCACCAAGTGCAACGCCTGCGACAAGACGGTGTACCTCGTCGACAAGCTCACCGCCGACAACCGGGTCT
ACCACAAGGCCTGCTTCAGGTGCCACCACTGCAAGGGCACCCTCAAGCTCGCGAATTACAACTCGTTCGAAGGAGTGCTCTACTGCAGGCCTCACTTTGA
CCAGCTCTTCAAGAGGACCGGGAGCCTCGACAAGAGCTTCGAAGGCACTCCAAAGGTTGTCAAGCCGGAAAGGAATGTTGGGAATGAGAATGCTATTAAA
GTCTCGAGCGCATTTGCTGGCACCAGAGAGAAATGTTTTGGATGCACCAAGACAGTCTATCCAATTGAGAGGGTTACTGTGAACAACACCATGTACCACA
AGAGCTGCTTCAAATGCTGCCATGGAGGGTGCACCATCAGCCCTTCGAATTACATCGCGCATGAGGGCAAGCTCTTCTGCAAGCACCACCACACCCAGCT
GATCAAAGAGAAGGGCAATTTCAGCCAGCTCGAGAACGATCACGACAAGACGTCACAGAGTGCCGGGTCAGTGGATGATGAAGACTCGGAGTATTAGTCA
GTCCTTGAGGATATCCAGAGATGAATAACGAGCCCTTTTGCATTTGCACCAGAGCAGTATGTCTTTCTGCTGTGTGGTTCTTTTGAGTTTTTCCAATCGA
GATCAAGTGCATTCCAAAGACAATTATGTTATTGCCTTGTACGCATGTAAACCCTTGTTATATCCCGAGTCAAAATT
page-top