Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7268  (registered. 2012)
Contig Information
Length 851 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_VWD Shoot grown with dessication 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115469974|ref|NP_001058586.1|| Os06g0715600 [Oryza sativa (japonica cultivar-group)]
Score 251
Evalue 5.00E-65
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7268
TTTTTTTTTTGAAAAAAAAAGCAGCTGATTTCTTCGAGTTCACGCCCGAGTTACCATAGATGTTCAAGAACAGAACAGTTCATACTAACTGTCACATGCA
GCAAACTTTACACTGGAGAGAATTCAACGACCAATATCCATATGTACACAACTCCAAGACAGGAAGAACTGAATTGCCATTTCTCCCCCAAAACCACCAT
GACCAGCAGGGGTGGCATCAACAAACCAACAACGCTCTATTGTACACAATTTACTTGCCAAATAGAAGCACTCTCTTGCCCTATGGACTGATTCTCCTGC
CTGGTCAGGCTGCTTCCTTGCTCCTCGCTCATCACACAGATAGTCGAGGACTACTGCTTACGGGCAGAGCGTGCAAGCCAAAAGGGTAGAGATGCTCCCT
CGTTAGCTACTTTGCTTGAGGGAAACCATCACTGCATAACTTCTTGAAATTCTGACACTCGTCAGCCAGATAGTCGTAGATGCGTTCCACCATTTCCGTC
ACTTCCCATCTAGGACTCCATGGATAGCTGTTTCTTGGAGGTGACGTGATAGGTATACCTTGGGAATTACAGTGCTGACAACTCTGCAAAGTCAGGATAG
GTTGTTGTTTGGGGAATTGAAGGGGGATGACAAAGTGAACCAGAAATGTGAAAATCCCCGAAATGGAAAGAACCGTGGCTTTCCTGCAAAAAATCGGATC
AGCCTCCAATGGTCTCCCGAAAGCAGGAGCTAGGGCTTCAATGAATCGTCTCCTGCAACCGATTGAAGCTGATGCATCCACGACCTGCAATTTAANNTCT
TCTTCTAAAGTGGGAATATACTCAGCCATGCACATCCCATCTACCCATGCA
page-top