Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7267  (registered. 2012)
Contig Information
Length 796 bp
Clones alternative view 4 Clones [Download: TSV  ,  FASTA ]
Wh_VABA Shoot with ABA treatment 1
Wh_VWD Shoot grown with dessication 1
WH_XN Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242081045|ref|XP_002445291.1|| hypothetical protein SORBIDRAFT_07g007870 [Sorghum bicolor]
Score 300
Evalue 9.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7267
ATACTTTAGTTCTAAAATTTTAAGAAGCAATATAGATAAAGTTTAAAATCCCTTCTCCAGGGTACAGAGATCACATCAGATCACTCGACAACAGAAATAT
CCATGAGCAAGCTTCCACAGCTATAGAGTATCTTTTACAATACTGATGCTTTCCGAACTCTGATCCTCTAGAAGAGATCTAACTGATATACACAGAAGAG
AAAAAAGGAAAAGAATAATGAAATACTACCAAATGACACAACAATCATTTATACGAGATTATATTTAAGTACATGTTCGGAAGATAATCATTTGTCAGAA
CTATTGACATCATAGAACTCGATGTCCTTATATTTCTGAGAAATTATTTCTGTCTGAACTTTCCGAGCCGTGTCGGTTGCACATCCGACAAGGATAAGCA
CTGATGTACCAGCGAATCCCCGAAATGCTGTCAAGTGAGAGACTTGTTCAACCACAGATGGTCCAGCAGCTAGTACAGCGAGAAAGGCAGATCCTAGGAC
AGAGATACGACTAAGAACTGTTTTAATAAAGGCAGCTGTATTTTTTCCTGGCCGCACAAGCGGTATTGACGCACCTGTTCGCTTCAATTGCTCACTAAGA
TCATCAGGATCCAATTGAAGGAAAGTGTAATAGTAATTGAAAAAGGCTATAAGCAATACATTAGTTGGAAGATAAAAAGAACCTCCTGGAGTTAGGGCTA
TGGCAGCCTTTTTAAGAAAATCTAAGCCAGTGAAACGTGCCAAAGTAGCAGGTAAAGCCAATGAAGATGTAGAGAATATGATAGGCATGACACCAG
page-top