Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19231  (registered. 2003)
Contig Information
Length 505 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 5
Wh_KMV Shoot grown with continuous light after cold treatment 2
Homology (BLAST) Top Hit putative proteinase inhibitor [Hordeum vulgare subsp. vulgare]
Score 245
Evalue 1.28818e-19
Total Hit Count 215
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19231
CCGGAATCAATTAACAAGCTCGAGGTCCATCTAGCTGCAGGTGAGTCGGATCACAAACACATATCCCGTCTGCGTGCCGGATCGACGACAATGAGCTCCA
CGGAAGCCACCGCCGCCGGAGGCCTCTTCGTTGAGGAGACGAAGGCGTGGCCGGAGGTGGTGGGGAAGTCCATCAAGGAGGCCAGGGAGATCATTCTGAA
GGACAAGCCTGAAGCCGACATCGTCGTCCTCCCAGCAGGGGCACCGGTCACCCTGGACTTGAGGCCCAACCGTGTGCGCATCTTTGTCGACACCGTCGCG
GAAACACCCTTCACTGGCTAGGCAGCTTTGCAGGCCCGAAGGAATGTATGCTTGCACCATGCATGCTCATGAATACGTTTTTATCAATGGATAAATAAAT
GCAGGCATGTAAGCATTAGCATGTCATGGATCTCTACTGATGTATATCTTTTTGCATTGTACTTTTAGTTTGATGAGAGAGTGCTAGATCCGAGCAAAAA
AAAAA
page-top