Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19222  (registered. 2003)
Contig Information
Length 1156 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 2
Homology (BLAST) Top Hit Os07g0608300 [Oryza sativa (japonica cultivar-group)] >gi|34395138|dbj|BAC84852.1| putative membrane protein [Oryza sativa Japonica Group] >gi|113611777|dbj|BAF22155.1| Os07g0608300 [Oryza sativa (japonica cultivar-group)] >gi|215741071|dbj|BAG97566.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218199997|gb|EEC82424.1| hypothetical protein OsI_26818 [Oryza sativa Indica Group]
Score 1330
Evalue 1.08037e-144
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19222
CCCCGCGCTTACCCCATCAATCCCTCGCGCTTCCGCCTCATCTACGAGGACGTCTGGCTCCGCGCCGCCGACGGCGTGCGCCTCCACTCCTGGTTCCTCC
GCCACTCTGCCACCTGCCGAGGTCCGACCATTCTGTTCTTCCAGGAAAATGCCGGCAATATTGCACATCGTTTGGAATGCGTTCGACTAATGATGCAGCG
GCTACAGTGCAATGTGTTTATGCTTTCTTATAGAGGGTATGGTGAGAGCGAAGGTTATCCTTCTCAGAGTGGCATCACAAAAGATGCACAGGCCGCACTT
GATCATCTACTTCAGAGGAAGGACATTGACACATCCAGGATAGTTATCTTCGGGAGATCTTTAGGAGGTGCTGTTGGAGCAGTTCTTGCAAAAAACAATC
CTGACAAGGTGTCTGCTCTAATATTGGAAAATACTTTTACATCTATATTGGATATGGCTGGTATCATGCTGCCCTTCTTAAGATGGTTCATAGGCGGTAG
TTCTGCCAAAGGCCCAAAACTTCTTAACTGCGTTGTTCGCTCTCCATGGAGTACACTTGATGTTGTTGCAGAGGTCAAACAGCCCATTCTCTTTCTTTCT
GGATTGCAAGATGAACTGGTTCCCCCTTCACACATGAGGATGCTGTATGACAAAGCTGTTGAACATAACAGGAATTGTAGGTTTGTTGATTTTCTCAATG
GTATGCATATGGATACCTGGATTTCTGGAGGGGACCGCTACTGGAGGACAATCGAATTGTTTCTGGACCAATATTCCCCAGAAGTACAGAGTTCTGATGC
CAGCTGCACAAGTGAAATTGCTGATGATGATAAAGCTGCATAATAATTGGAACATCTAGAGCAGCCTGCTGTTTTCCACCAGTTTTTCTGATGTTGATGC
AATTCCGGTCTTTGATGGATTGAAGATCATTTCAAACAATTAATTCAGGTGGTTGTTCTGCTCCATTCCACCTGAAGAAGCCAAAGCTGTGAATATATTT
TGAGGTTGTTCTCCATCCTGTGATGCTGCTGCATATGTGTATGGAATGACACATATATATTTCTGAGCCTGGCTCGGCCTTCAACTCCCGAGTTTCTGTA
CAATGTTGAATTGGCTTCATTCAAGTATTTGCAATTTATTGGAACTAAAAAAAAAA
page-top