Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7265  (registered. 2012)
Contig Information
Length 1236 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 4
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 8
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 1
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 2
Wh_VWD Shoot grown with dessication 6
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23Ž ) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XE Seedling, infected with leaf rust 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32492882|gb|AAP85531.1|| myo-inositol-1-phosphate synthase INO1 [Xerophyta viscosa]
Score 541
Evalue 6.00E-152
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7265
ACATGATAAAAGCAGAGCACACAACTCGCCGGTGAACCGATTTAAAGTTCCATATACTAGTAGCACACATACTACTAATTAACTTACAAAACACGAACAG
AGGGAGTGGACTAACTTAGCTAACACGAACCCTCCTCCCTCCACATCATCCAACACCATGGAGCCCATGAGAAGCTACCAAGTCGCAGAGACCAGACAGA
GAGCCGAAATAGTCTCGCAAGGACACACACACACACTACAGGGTAAACTTAAACAAGGGAAAGAATCGCAAAGGAAACTAAAGACAAGCCGCCAAATAAT
TGCACAGCCGATCTCGCCTTCTTCTTCCTCCTGCCCTCCCGTCGCCCCCCGCCACTTGCTACATACGTACGGTCGCTCTCGGCCCTGCGAGCTTGGGCCA
TGCTCCTCACTTGTACTCCAGGATCATGTTGTTCTCGGGCGCCAGGCCGACGCAGGCCCTCATGATGTTCTCCAGCATCGCCCTCTGCTTCGCCAGGGCG
TTCACCACCGGTGTGCCAGGAGGAACCAGGGGTGCCTTGGTGAGGTAGCTCAGGATGGTGGCAACCGGATGGAAGGAGTGGAACTTGTCCTCTCCCTCGG
CTTTCAGCTGAATCCTGGTGCTGAGCTCGGCCAGGAGCACCAGGTCAAGGATGATGGGTGCGGCGAGGAGCGAGTCCTCGCAGGTGTTGTGCAGCACGAT
GGTGCTCTTGCCCCCCATGAAGATCTCCGAGGTGTACTCGTCCATGGCCCTCTTGCTGTCTCCAACGTATGGCACATACTTGATCACGACGACGTGGTCA
GGATGCTCCCCGGGCTCGTAGAGGATAGCATTGCTCGAGACCATGTCATCCACCACGTTGCTCTTGGAGATCTCCTTGGAACGGAATGTCTGCGGTGCGG
ATAGGTTCATCCCGTCGTTGTTCCCCAGATGGTTGTAGCTGACAATTGAGGTGGGCTTGATTCCAGCACCAACAAGGAAATCCACCAAGACAGATTTCAT
CTTAGTCTGGCCACTCTTGAAATCATCACCACCAATCAGGCAGTTGTTCTTAATGGCAAGATCGATCAGCCCAGGCACAAAGGTGTTCTGAGGGCTCCCG
TTGATGAACGGCACACCCTCCATGACGCAGGCAATGGCATACAGTGTCGATGGAGATATCTCTGCCTCGTTCTTGTCCACAGACGCCAAGAGGTTCTCCA
TCGTGTCATTAAGCCCAACAGAGACGTTGCTGTACC
page-top