Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19212  (registered. 2003)
Contig Information
Length 1953 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 2
Wh_SHDr Shoot grown with dessication 1
Wh_V4816 Shoot grown under cold condition for 16days 2
Homology (BLAST) Top Hit beclin 1 protein [Triticum aestivum]
Score 2273
Evalue 0
Total Hit Count 210
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19212
TCATTTCTCTGCACTTGTAGCGCAAAGCTGATAAATACTGATCTAAACGATCTATTTCTTTACAGAGGGAGTACATATTAATGGAACTCACTCCAGTCCA
TATTCATATACATTGGGCAGGTACACACATGGATGACTTGGAAGCAACAAGAAAACTAGCTATGCCTGGTATTTATGTACATCAATTTCATATTGTTGTG
ATTGGTCAACATGCGGCTACAATCAACGATCCAGCTTCTGAGGTCAGTGATTCCGTCTGCATTTAAACATCACATCAACCCTTCTTGTTTGGAGACTGCG
CCAAGTACAAAGATGCAGATGGCGGCGCGAAACTTGTATTGCCGATAAACCAGTAGAGAACCCACTTCAGGTTGCAAAGCATATATTTTAGAGCCTTTGT
CCAGTTCTCCAGTTTATTAAAACTTAAGAAGATTGTGTAGCTCCCTACTTTGTCACCATCAATCTTGTAGGGGAGCTTCAATGACTTATCAGATGGAACA
TTGTTCTCTTTATCCAAACTTATGGCAAACTCGGAGAACTCTTGCAGGCAAGTGAGAAACCATGTCATGGCTTTGTCAAACCGGGTGCTCCAGAATAAAT
TTACAGGACCAAACAGTTCATAGGTATTATTGTTGATGTCTGTTACTCTTGGGTAGCTTCCCATAGGGTGAATCTTGATTCGATATTGAAATTTCGGGAA
GTACTGAGCCATGGTGTGTAACAGAAGAGCAGCCTGACCCCAAGCAGCATTTATCTCATCCCACTCAACCTGTACATTAGGCAGACGACCGAGACGGAAG
TTGTTTATTGTTCCAATCACTCCATCATGTGAAATATAGAATGCATCATTGAGAACATTTGTGCGCTTTAACAGTTCCAGGTGGACCTGTGAAACTTCTA
TCTTGGCCAAAACCGCATCTCTTTCTTCCTGGTGAGATGTCAGCTGAAACTGGAAGCTGTTGAATTCATGCCAATACCGCTCTTCTAATTCTTCAAATTG
TTTAGACTTTGTTTCAAGATCCTTCATCTCAGAGCTAACTTCTGAATATTGCTTTTCTGCTTCTTCAATAGCAGCTTTTAGTTTCTTTTCTTCTTCCTCT
ATCTTCTCTTTCTCCTTGAGGAAATCAGTTTCGCTAAGGATGTTGTAGGATTCCTGCTCCAAACGTTGAAGACATGCATCATAAGCTTTGATGTCAGTAT
TTACATCCTCAATCTCCTTGTCCATCTTATCAGAAAGCACCCTCATGCATTCCAGACAGAGTGGCTGCTCAACCTGAGTTTGTGAACTAGCAATCTCAAA
TGCCCGCTTTAAGACAGTCACACTAGAGTGAAATCCAGAATTGTTGCCTGGTGAAGGGCTAGTAGAGTTAACATTTGGAGGCGACAGATGCGCGCCACCT
CCTTCGGAGGTAGATGTCTTGTATATGGAAGCAGCGGCAGGTGGAAGCATTATATATGACCCCTCTATTGCTCTTGTTGATTGGTTAGGCTCAACATGCC
GGGCTGCTGCACTAGGTGGCCGTGGGGGAATCCTGGGGCCTTGAGATCTGTTCTGCTTGGACAACACAACGTAAGAACTGTCCATCCTGCTCGCCCCCAT
AATGCTGCCCTGAACAGAGGATGCATGTATACCGGAGTTGGCGTGAGCGGGCAACCTATCGGGGAATGACTCCACGCCGACGACGACGAGCGCCCGGTGG
CATTCCTGGCACTTGAACCGCGGCAGCGACGGGTCCACTCCCCGGCCCTTCTCGCCGCCGGCAGCGGCTGCGGCAACCTTGGGCTTCATGTCGCAGCAGT
AACTCGGGTTTAGCTCCGGGCGTTCTCGCGCTTGCGGGATTCCGGAGCTATGTGTGTGCAGGATTCCTCCGCCCTTCCAAGCTTAGGATTCCTGCTGAAC
CCCGGCGTGGGGGGATCGAATCGGAGGCGCGGTGAGTCCGACCTGGACTCCAC
page-top