Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7261  (registered. 2012)
Contig Information
Length 1281 bp
Clones alternative view 21 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 1
Wh_VABA Shoot with ABA treatment 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 4
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|188593543|dbj|BAG32519.1|| transcription factor [Hordeum vulgare subsp. vulgare]
Score 451
Evalue 7.00E-125
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7261
TAATAATAATAATAATATTAATGACGATGGTTCAAATACAGTAGTACTACTTTGACAGAAAATAGATAGAAGATGCGACTTAAGCTATTAAGTTGTCACT
AGGTTTATGGACAACGCATCAAACATGGCAGTTATTACAGAAAGAACAAGATGGACTGCAGCATCTCCACCCAGAGAAGACATCTTCCAAACCAGCAGAA
AACAGTTTCTCCGCGGTATAGCAGTAAGCTAAGCTCGGTCTGTGCTCGTGATTGAGACACAACCAAGTTCCGGCTTCTTCAATAGAGCAGCAGCCATGCC
ATGATACAAACACCATTGTTGGGTCATCTCGAGCAGGGACCAACATCCAAGATCCATCAAGAGTCACATCAGACAATGATGGACAACCAAAACCAGAATC
AGCAGCAACTTCCAACATCAATGACCACAAAGGTAACAGACTTGGTACCTCAAAAGTTGCTATCTATGAGAATGGGTCTTTCATGGCTGGGTTCAAGCAG
TAGGAGCTTGCAGGCTTATTGGAAACAGAAGGCATGTCATCAAAAGTGCTAGGCATTGGTTCCAATGGTGGAAGCGGTCCACTTGCTAAGAAAGTTGATT
GAGTGGCACCATCACCGTAGTGAAGGCCATTAGATGATTGATCCAGTGGGTACTGCGAAAACTGATTGTTTGGCACAGACAAATAGGAGAAGGTTCCACC
AGGCAAATCATAGGAGAATGTTTCACCAGAAAAATCATAGGAGAAAGTTTCCCCAGGAGCAAACAGATCATCCAACCCTATATAATCATCATCCATAGCA
AGTCCAGAGTTTGTTTGCTGCAAATTGTTTTCAATAACATCCCCGTTGCTAGCAGGGAAATTTGCAGCAGGCATATCTCCTGACTGGGCAAGTACTGCCA
ATTGGTCATAGAGCTCAGCAGTATTTATCTCAAAAGCTTGAGCCTCAAGCTCAGACATTGGAGGCAGACCAGAATTCTCCGGCGAACGTACGTCATGGTT
GGGAGAATCATTCAAAAACTTTGTCAGTTCGTCCAACAATATCCCATCAATTTCAGGAGGCGCATCATTGACCTGATCAGAACAGATATTAACATGTTCG
GAAAATTGAACAGATTGCTGAGGAGCGGATGGTTCGTGAATAACTATTGCAGTAGCCAAGGCAGAACTTTCGATCTGTGGATCCTCTACACCTGAGGACG
GTGCAAAAGAGAAGATAGAAGATCCAACATCTAAATTCTCCCATTCGTTTTCATCAAAAGGAGCCCCATATTGCTCACCAA
page-top