Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19172  (registered. 2003)
Contig Information
Length 1532 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 1
Homology (BLAST) Top Hit hypothetical protein OsI_21147 [Oryza sativa Indica Group]
Score 999
Evalue 3.82503e-106
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19172
GGAGCATTGGGTGCATTTTCGCTGAGGTGCTGACAGGAAAGCCTTTGTTTCCTGGTAAAAATGTTGTCCATCAGTTAGACTTAATGACTGATCTCCTAGG
GACACCTTCAATGGATACAATTTCTCGGGTCCGAAATGAGAAAGCAAGAAGGTACTTGAGCAGTATGAGAAAGAAAGACCCGGTCCCATTTTCTCAGAAG
TTTCCTAATGCAGATCCTTTGGGAGTTAAACTCTTGGAGAAGCTATTAGCCTTTGATCCAAAAGACCGTCCAACTGCGGAAGAGGCATTGACTGATCCAT
ACTTTAGAGGCCTTTCCAAGCCAGAGAGAGAACCATCCTGTCAGCCAATCAGAAAAATGGAGTTTGACTTTGAGCACAGCAGAGTGTCAAAGGATGATAT
AAGGGAGCTGATATTCCAGGAGATATTGGAATATCATCCGCAATTGCTGAAGAGCTACACTGATGGCACAGAGAGGACAACCTTTCTCTACCCAAGTGCT
GTCGATCATTTCAAGAAGCAGTTCTCTCATCTTGAAGAAAGCGATGGCAGCGGCCCTGTAGTCCCAGCAGATAGAAAACATGCATCTCTTCCTAGGTCCA
CTATTGTTCACTCGACTCCAATTCCCGCGAAGGACACTCGGCCGCTCTTTGGCAAGCCTTGCAACAAAACTTCCTCGGAGACAGGGAGGTATGCTGGGAA
TGGTCACGGTGCTTCTCAGGCTTCACACGCGGCACAAGCAGTGATTTCGCGGAGAGCTGCCGGTTCAGCGTTACCTTATGACGCGGCAAGCAGGCCGACG
ATTAGCCCAGGATGCCCTCCTCAGCAGCAGATCCCACAAATGTATGGGCAATATCAGCATCAAGCACCTCCTGGTGCTGGTGCTGGTGCTGGGATACCAC
AGGCCATGGGGGGCTATGCCTGTGGTGGGTACACCAAAGGCACGGCGCCTAATGCTGCTGCTGCTGCTCCGGCCATGAGAGCACCCCCCTATCGACACCT
ACCGACGGGGCAGAAGAACGGCCCGCTGGACAGACTGGCAGTGGAGACCACCGACATATACACGCGGTCGCTCAACGGCATCGTCGCCGCCGCCGCGGCA
TCGGCCGGTGCCACGGGCGCCCACAGGAAGGTGGGCGCCGTGCCGTTTGGCATGCCGACGACTTACTAGCGGCTAAGAAGGCGGCAGCGGCGCGTACCTA
GACCCTTCGGCCGGAACAGTAGCAACCGGAGGGAGGCATTGGCCTGAAATAAGTTGGCGGATGAGGATCGTCCGACGACGACGACGGCGGCGAAGGCATA
CAGAGATAGTAGGTGCGAAATCCTCTTCCAAGTCGTCTCTAGGCTACACACAAAAGACGGAGGGACGGGTGTGGCCAGACGAGCTGTTTATTTAGGTGCA
AATGAAAATTAATTAGCTGGTTAGCGGCCGGCTGGAGACAGGTCAACTCAACACAGAAATGAAGTCTGTACTGTGCTACTGCTTACTATCCAACAGACTG
ATTAATTGATTAAAGGGATGATGTCCATGATC
page-top