Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19170  (registered. 2003)
Contig Information
Length 839 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 3
Homology (BLAST) Top Hit tryptophan synthase beta-subunit [Sorghum bicolor]
Score 1077
Evalue 1.40865e-115
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19170
TTTATTTACCAAGTTTAGCATACAACATATTTTTATTTAGATAAAATTCAACAAACCAAACTAAATTAGCTATAGACCAACCGACTTCCAGGATTATTTG
TACCCTCATATTGTACCCCAAAGAACAACACTAAGCGATTGCTTTCTGTTTTCACTTTCAAAACTGCTCATACGAAAGCCATCATTGTTTAGTCTTTCCG
GAGTTCTAGACTTCAAGGTACTTGCTGGCTGTGTGGACATCCTTGTCTCCTCTTCCACTGCAGTTGAGAACCACCCTCACACCATCCGGTAGTGTTGGGC
AGAGCTTCTCCAGGTAAGCCAGCGCGTGGGATGTCTCCAGGGCAGGGATGATGCCCTCCAGCCGAGAGGTGCGCTTGAAAGCGTCCAATGCCTCCTGATC
TGTCACACTATCATATTCAGCACGTCCAATATCCCTCAAGAAACTATGCTCAGGTCCAACACCTGGGTAATCCAACCCAGCACTGATGGAGTGGGGCTCA
ATCACTTGTCCATCAGCATCCTGCAATACATAACTCAGAGATCCATGGAGAACTCCGACTTCCCCCTTCGTTAATGTTGCAGCGTGCTTGTCAGTGTCTA
CACCATGACCAGCAGCCTCCACTCCAATCAGTCTTACATCCTGATCATCAACAAACTCATGGAAGAGACCCATGGCATTTGATCCACCACCAACACAAGC
AACCAGCACGTCAGGCTTGCCACCCCACTTGTCCATCGCCTGTCTACGGGTCTCCTTGCCGATCACCTTATGGAACTCCCTCACCATCATCGGGTATGGG
TGTGGACCCGCAACTGAGCCCAAAATGTAGTGTGTGGTC
page-top