Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19146  (registered. 2003)
Contig Information
Length 1122 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 2
Wh_EMC Dormant seed with cold treatment after water absorption 4
Wh_EMI Dormant seed with water absorption after breaking 1
Homology (BLAST) Top Hit hypothetical protein OsI_36708 [Oryza sativa Indica Group]
Score 157
Evalue 1.08371e-08
Total Hit Count 279
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19146
TAATGTGTTTACAACCTTAAAAAAAACTCATGTTTTTACAGACTCCCTTTGTAAGCACGTGCAATTGGTCATGGAAAAATGGTAAGACATTGAACCAAAT
ATGCAAGCACATGTACAGCAGCAACATGTAAAAGGAGAGGAGGAAGCAAAGCCATGTAAATTGACTTCCGGAGATATTTGGCGTCACTGAAGAGCACATC
TACAGCAGCAACATGTAAACGGAGAGGAGGAAGCAAAGCCATGTAAATTGACTACCGGAGATATTTGGCGTCATGGAAGTATCCTAAAATACTATGAAGC
TCATGTCCAAGACGACAGATGACAAGCTCCGGCTCTCAGGCTCTCAGCAAAGGGACACATGAATACTGGCACCTACAAACAAAGTTGCCCCCTCCAGCCA
TTCAACCATATCGGGATGGGGAATACGCAGCTTGTTCTTGATCACAACATCATGATAGCAAAAGCCAGAAACACTATTTTGATTTGCACTGGTGCCCCTA
TGATATACTACTAGTTCCTATATATCTTTCCTGGGTCGGTGAACTTGAGCTGCTGACTGCTGGTGCGCTGATCTTCGTGTTCCTCAGGACTTTTGAAATG
TGAGCGAAGGGCAGGCCTCATCGGAGAAGAAAAACAACACGCGTCATGCAAAACAACATGTGAAGATTTATTAAGTATGGTGTGTCAAAAACCAATCTCT
AGTCGGATAATCGTAATAACACGCAAATTAGTGTCTACAAATAATGTCACTCTTCCTATGATGACATAATTAATAGAACTGAACATATTTAAAATAAGAC
TCCAGTAATTATCTATATAAGAATATTTTAGAGCGAGAACATATGTCCGCATGAAAAATGAAGTAGCGAGAGCTACTTTGAAGAAATCTGGAGGTGTACC
ATTAGCCATCATTACTATAGCTAGTATTTGGGTTAGTAATAATCAAATAGAGCAAACAATGATTGGTTGTGCTTGCTCAATGCTATGGGTTGTGGGGTTA
CAATAGGTGCTAGTTTGAAAGGAAAAAAAAAGATATTATTGCTCAGCTATTATGATCTGCCTTCTCATCTAAAGGCTTGCTTATTATCTAAACATATTTC
CCAGTAGTCCAATGGCTCATGA
page-top