Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19109  (registered. 2003)
Contig Information
Length 1033 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_EM Dormant seed with water absorption 4
Wh_EMC Dormant seed with cold treatment after water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit tropinone reductase 2 [Zea mays]
Score 751
Evalue 1.24758e-77
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19109
CCCTGGCCGCCGCCAGGGCGCTCATCACCGGCGGCAGCAAAGGGATCGGGTACGCCATCGTGGAGGAGCTCGCCGGGTTCGGTGCGAGGGTGCACGCCTG
CTCCCGGAACGCGGCGGAGCTGGAGGAGTGCCGACGGCGGTGGGAGGAGAAGGGCCTGCATGTCACCGTCTCCGCCTGCGACGTCTCCGTGCGCGCCGAC
AGGGAGAGGCTCATGGACACCGTCCGGCAGACCTTCAACGGCAAGCTCGACATACTAGTGAACAACGCGGGGCAGCTGCTGGTGAAGCCCACCGCGGAGT
GCACGGCGGAGGAGTACTCCAAGGTGATGGCTACCAACCTGGAGTCGAGCTTCCATCTCTGCCAACTCGCGCGCCCTCTTCTCGTACACGCCGGAGGAGG
CAGCATCATCAACATGTCCTCCATTGGAGGCTCAATTGGCTTCGTAGGCTCCGCAATCTACGCTATCACAAAAAGTGCAATGAACCAGCTTACTAGGAGT
TTGGCCGCTGAGTGGGCTCCCAACAACATCCGTGTGAATGGCGTGGCCCCAGGATTTATCACAACCGATATGATCAAAGATATGGATACAGAGTCCTTGG
AGCGGGAGCACTCAAAGACCCCGTTACTGCGGAGCGGCAAGCCGGTCGAGATCGCCTCGGCGGTGGCATTCCTATGTATGCCGGCAGCTTCCTTCATCAC
CGGCCAGGTCATTTGTGTCGATGGCGGTCGAACTATTAGCGCTTAATTAGCCAGCACCACCACTGCATAAGTTACTCGGGCGAATAGTTAAGTAGAGTGT
GGGAGAGTGAAACAAAAATTAGTGAATAGACAAATAAATTAGTGATGCCAACTAGTGTCATCATGTACAATAAGTATATGTCAGTATGTAGTGTGGATTT
CTACAAAGTTTCTGTATTGGACATCTTTTAATGGTTGCTGGTTCTACACTGTAGATGGATGGGGGGCTATTGTTCTGTTAGTACTGGAATTCTAGTGAGC
AATTGAACCACCCTTTCCTTGAGTGGATGTAGC
page-top