Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19051  (registered. 2003)
Contig Information
Length 2007 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_PCDAM Anther at meiosis 1
Wh_SHDr Shoot grown with dessication 1
Homology (BLAST) Top Hit Os03g0701800 [Oryza sativa (japonica cultivar-group)] >gi|50470594|emb|CAD67588.1| phosphatidylinositol 4-phosphate 5-kinase [Oryza sativa (japonica cultivar-group)] >gi|62733391|gb|AAX95508.1| Putative Phosphatidylinositol-4-phosphate 5-Kinase [Oryza sativa (japonica cultivar-group)] >gi|108710617|gb|ABF98412.1| Phosphatidylinositol-4-phosphate 5-kinase 1 precursor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549476|dbj|BAF12919.1| Os03g0701800 [Oryza sativa (japonica cultivar-group)]
Score 2815
Evalue 0
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19051
TGGCACATCTACATCGGAAGCTGGAAGTCAGGTAGCATGAACGGCCGAGGCGTAATGCAGTGGATACATGGTGATACTCTTGACTGTAATTGGCTCAGTG
GGCTGGCTCATGGGAAAGGCTACTGCAAATACGCATCAGGCGCATGTTACATTGGTACGTGGGATAGGGGAGTCAAGGATGGCCATGGCATATTTTATCA
ACCGGGAAGTAAAATACCTTGTAACCTTGAAGTTTCTGAGTGTGCAACAAATAATGATGGTACAAGTGCTTCAAGTTCTAGTAATGAAAAGGTCAAAGTT
GGACTGTTGTTTCTATTGCAAAATCTGTGCAACAAATGGGGGCTGCGTAGGTTTTTTCATCGCCCCAGGCGCATTTCAAATGGCACAACGCCAATTTTTG
TTGATGATTCCGGAAATCACCTATCACAAGATCTTCCCAATAAATCCTTGTCAAGTAACGAGCATTTACAAAACAGTGATGTTCATAAGGATTTGGTCTA
CGAACGGGAATATATACAAGGAGTTCTTATCTCCGAACAGCCAAAGGGCAAACATTCTGGAATGTTGGACAGCGGTGAAACACAGGAAAATACCTGGCAA
AAACAAGAAAGAGGGCCAATGGAGACTATTTACAAGGGTCACAGGAGCTATTTTCTAATGCTTAATTTGCAACTCGGCATCAGGTATACCGTGGGTAAAA
TCACCCCTGTACCTTTGCGTGAGGTTCGTTCAAATGATTTTGGACCTAGGGCCCGGATAATAATGTACTTCCCTTGTGAAGGCTCGCAGTATACCCCTCC
ACACTGCTCTGTCAATTTCTTTTGGAAAGACTATTGTCCTATGGTCTTCCGGAATCTTCGGGAAATGTTTCATATTGATGCCGCAGATTACATGATGTCC
ATATGTGGGGGTGATAGTCTAAAGGAGCTTTCTTCACCTGGGAAAAGTGGCAGTATTTTCTATCTTTCCCAGGACGAACGATTTGTTATAAAAACATTGA
GAAAAAGTGAACTGAAGATACTGTTGAAGATGCTTCCAAAATATTACAATCATGTCAAAGCTTATGATAATACTCTCATTACGAAATTTTTTGGCGTGCA
CAGGATTACGCTAAAAGCTGGAAAAAAGGTCCGTTTTGTTGTGATGGGTAATATGTTCTGCACTGAGCTGCGAATTCACCGTAAGTACGACTTGAAGGGA
TCTACACAGGGCCGGTCAACAAAAAAGCAAAAAATTAATGAGAACACAACATTAAAGGATCTTGACCTAGCACATGCATTTCATGTTGATAAATCGTGGA
GGCAAGCGCTTTTCAGGCAGATAGCTCTTGATAGTATGTTCCTGGAATCCCAATCGATTATTGACTATAGCATGCTATTGGGAATCCATTTCAGAGCCCC
CAATCACTTGAAGACTGCCACGTCACATCAGAATACACTCGAAAGCAGTGGAATTACGTCTGCAATGGATTGTAACGTGCCACTGCATTGTGAGGATGCG
AACTCCTCAAAGGGATTTCTTCTAGTTGCTCACGAGCCAGGTACGACCGTAGGCGGTTCCCACATCAGAGGGAGCATGGTTAGAGCATCAGAAGGTGGTT
ACGAAGAAGTCGATCTTGTTCTGCCAGACACCGGCAGGTTCCGTGTGCAGCTAGGGGTGAACATGCCGGCCCGAGCTCGGAAATTGCTGGAAAGCACGGA
CGCGGTCGAGGAGTACGACGTTGTGCTCTACCTCGGCATCATAGACATACTGCAGGAGTACAACACGTCCAAGAGGGTAGAGCATGCGGTCAAATCGCTC
AAGTTCGACCCCCTTTCGATATCATCTGTTGATCCGAACTTGTATTCGAAACGATTCGTTAGTTTCTTGGAGAGGGTTTTCCCTGAGCAAGACTAAAATA
GAGAGGACATGAACGGTACATAGCAGTAATGGGTATTTTTGTTTTCTGGTTGTTGTTTTTGTTGTAAAGAATGAACATATTCTTCACTGGAAATACTCGA
TAGGCAA
page-top