Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19038  (registered. 2003)
Contig Information
Length 867 bp
Clones 7 Clones [Download: TSV  ,  FASTA ]
Wh_GCPCDAM Anther at meiosis of DT4B CS wheat 4
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Homology (BLAST) Top Hit hypothetical protein OsI_16615 [Oryza sativa Indica Group]
Score 891
Evalue 5.5037e-94
Total Hit Count 89
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19038
ATTTTCTACAATTTGATTACTCATAAATTACATGTATACAGTATTACCTATGAGTAGTTATGGATATATCACACTTATGGCTTTCTATCTAGATATATGT
AGACCCTGCTCAATGAAGCTAGCAAGCTGATAAGCATATCCAACACTCCTTATTCTCCTAACACTGAAGCTTAACTTTGCATCGTTGCTGAGTAACATAT
CTGTCAGGATTCAGAAGAATCAAGCTTTTGACAGAGGAATGAATCCGTGCCTAATAGCCGCCGACCAAACCTTTTCGATGTCCATCATATCATCTCCGCA
CTCATGCATGTTCCAACCTTCCTGAGCATGTATTATCCCAGCAATGCGCCATGCGCTCATCACCCTTCTTGGAAGCCAATTCTCACAGGCATGGACGTTC
TGCATCGTCTCCGGGATTTTCATTGCTGGGGTACTCAGGTAAGTGCAATCCTTGCGTGTCTTCTTAAGGGGAAACTGTGATGTAGGAATAAATATTGTTC
CACTTGGTGCCCTCCTTTGTTGTTTATCATCTATGATATCTCCTATCCAGATCTGGGGTATTTCATCACTGGAGAATTTCAGATAGGCAGTGCTGCTCTC
TGGAACCCGCAATTTAAGCATGTCATATTCATTCTTTTGGTTCATGATTACCTGGACACCTCTCTTACATAAAGCTGTAGCTGTGGCATGGGCTACCTTA
GAACTGCTTCCAAACAGAAAAACTTGCTTTGTATATAAAGGGATGCTCTTGAGCACCACTGCAGTTGCTAAGCCACTTCCATCAACAAGACGAACTCTTA
ATTTTGGATACTTTTGTGTAAATAATTCACCACTTCCATTGAGTTGTTTTGCCTGGATTTAACAGTC
page-top