Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig19004  (registered. 2003)
Contig Information
Length 1334 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 2
Homology (BLAST) Top Hit hypothetical protein OsI_05465 [Oryza sativa Indica Group] >gi|149391559|gb|ABR25797.1| ankyrin-1, putative, unknown [Oryza sativa (indica cultivar-group)]
Score 693
Evalue 9.70765e-71
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig19004
ATACTTGGTACGGCAAACAAAGCAAAGGTTCGACAACGTATGTTTACAAAGGATGTTCCTTGATAGAGACGGATATTCCAATCTGAGGTCACTGCAGCCT
GGTCACCGATGTACCAGAATATACCAGGTAAACTACAGGGCAGCTCAGCAGCAACTCCAGGACCTCGTGACGGCACCGTGTTTATTCTTGTATACACATA
CAATACCAGCATCAGCCTGCTTTCACTTGGACGTAGCTCCTCGCAGGCTCGGCACATAAGCTAGGTAGGGTGGATTTCATAATTAAAAACAAGCACTCAT
AACCCAAAGATCAGCAGAATCCCCTGCGGATAAATAACTTTTCACTAGTTGGACGAGCTGAAGGAAGCTTCGCCGCCCGAGTCACTCTCGTCCTGCATGC
GCTTCATCTCGTACGCCCACTCCAGCCCAGAGCAGTAGTGGAGGGGTGGGTTGAACCTGTGGTCGTTCAGGTCAGGGGGCAGGAATGCGCCGTTCTCGAC
AAGGAACCTGACCACCCTCTTGTTTCTTTCCTTGGCAGCAATGTGCAGGGGAGTCCAGCCACAAGCTCCTTTTGTTCGGGCATCAATATTTGCACCGCGC
TCCAGTAGTTCATCCATGATTTTCACATGCCCGCCCTGAGCAGCAAGGTGCAGCGGAGTAGCGCCAGGAGACTTTGGTCCCCATGCGGGTGCATTGACAT
CCATCCCTTCATTCAGGAGACGTCTCACCTCCTTGAGGTTGCCCTTGCGGGCGGCGACGTGGAGCTGGTTCCAGCCGCGGTCGTCGGCGTCGTCCGAGTC
GCCGCGGGGCGCGCGCCCGGGTCATGCTGAGCGAGCTGCGGAGCTGCACCATGGCCCCTTGGCTAATCTTGCAAGCAGATCCAAACCAACCAAGCAATCA
AGCAGAGAGAGGAGCAATCCAATCCAATCAAATCAAGAACGAGAAGGGGGGAGAAGCAAATCGGATCCGGGGAGAAAAGCAAATCAGAGCAGAGGAGAGG
GGAGGGGAGGGGGGATTAGCGGGAGTAGTTGCCCATGCCGAAGGGGGCAAACGGATTGAGGCCGGGGCCGAGCGCGCGGAGGTTCTTGTGGAGCATCGGC
GACGAGGAGGAGGAGGAGGAAGACGGGCGGCGGCGCACCATAGTATGTGGAATCTGGATGTGGGATTTCCTGGGGGGACAGATCAGAGGAAGGTGTCGAA
GGAGTTGGGGATCATATCTTATGGAAATCGATGAAAAATCACAAATTTGATCGGAGGTGGGGAAGACGACGGACGGCGACGGAGGAGGGGATGGGGATGA
GGATGAGCAAACCCTAGAAATCCAAATCGAATCC
page-top