Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18951  (registered. 2003)
Contig Information
Length 1147 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_V4816 Shoot grown under cold condition for 16days 1
Homology (BLAST) Top Hit biostress-resistance-related protein [Triticum aestivum]
Score 1180
Evalue 2.64108e-127
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18951
GTCTCTGACTTTGGATGGAAACACATACCAAATATATGAAATTTCAATAGTACCAAGATTCAGCGAGGCATGTCCGCATATGAAACGCCAAGCTAAGACA
TGACCGTATACCCAAAGCCCAAGTTGGCAACCAAGCCATTTTATCACTCAATTCGGCACAACCACAGGTACTTATTATTTAGACGCCGCTACACTGAGCC
TTTCTCAAGGCATCTCTTCATTCAATCAAGTTGACGATGAACTGCCGAGTTCCAAGCTTGCTGTAAGCCACTTGACAACTTCGTCCATCTCCTCTGGAAC
GGTATAGTGCCCGAGTCTGCTGTAGGACTTGAATTCCACATTTGCAAACCCGGTTGACTTAAGTGCATCAGCAGATCTCTCTCCATGTTTGTAGAGGACC
ACATCATCAGCTTTTCCATGACAAAGCATAAGAGGTAATGATGAAGCCTTCTGTGCAGCCTCCTGTGAGCTCTCAATTTTGTTCTTCAATGACCTGGCAC
ACGGGAGCCAGCCACTGAGACCAACAGCCACACTTAGGTTCACAGGGTATGGATTGCCATTTCCATATTTTCCATGAGCAAAGCAAGTACCGGAGTAAAG
CGCAGTAGCAGCACCCATACTAAAGCCACCAACGCCAAGCTTGATGTCTGCAGGTTCGGTAGACAATAAATTTGCTACATGTGCAGCTGAGGAATCCAGC
CCCTCAACATCATCAGGAGAATCTTCTGAAAGATCAGCAACATCAAACCATGCAGTAGATGGGAATCCACCAAAAATTGCCACAGGCCTCGTAGGTGCAG
TTGGGCAGATCCATTTTATATTAGGAAGGGGAAGAGTTTCCAACAGTTGAGACCAGCTGGCTCCATTGTCGCCGAGGCCGTGGAGCCAGACGATGGTGGC
CTTGTGCGCGCCCTTGGGCCTCACCACATGCGTCCTCCCGTACTCGAACGGCCGCTTCCCACCGGCCGCAACGGAGCTGGCGCCGCCGAAGCTCATCCCG
CGAACAGTCGCCGCCGCCGCCGGCACCCCTCCTCTCCTGGCGACCACGCTCGCCAACGCCACGAATCCAATGGCCTGGGCAGCAAAGGGGTTAATAAAGG
CGACGGGCGCGTGCGTGCGTACGAGGGAGAGGGCTGGGAAGAGAAAG
page-top