Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18943  (registered. 2003)
Contig Information
Length 1437 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Homology (BLAST) Top Hit FD-like 6 protein [Triticum aestivum]
Score 1327
Evalue 3.25822e-144
Total Hit Count 296
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18943
TTCTGGAGGGGGCTACAGGTTACAACAGCCAAACTTACAGCAAGTATTAGCAAGAAACTTCGCAGCACGATCCGTACACCGGGATCCATGCCGCAAGAAT
ATTTGAAAGAACCAGATTTACAAATCTGAAACCTAACGGCCGGGAGGATATTTCACAAGATTGTTGGGTGCCCTAGGCCTTTACAAATTACAAGCAAAGC
AAACTGCACACGCTCCATAGTTACATGCGAGGAGAAAGCAAAAGGGTGATCAAAATCTACCAGAGGCCTGTACTCTACACACAATTAGAATGAGGTCGAT
CTCGTTCTCCGATGATGTTTTTTCGGTTCTGGAGGGGGCGCGGACTTCAATAACATGTCCAACTCCTTCTCTCTCTTCAGCCTCTTGTTCTCCTCTTCCA
GACAAGACAATTTGCATTCGAGCTCGTTTGTGTAGGCCTGTTTCCTAGCTCTTGAACGTGCAGCCGATTCTCGGTTCTTGATCATCCTCTTCTGCCTCCG
ATCAGCAACCTTGTATACCACATCCTGGGAAGACATTCTCTTATGACTAGGACTTTGAAGATCAGAAAGTTCTAGAGATGACGAAATACTCATTTGACGA
TCTGGGTAGATGGAATCCATTGTCGAAGGGATTGCAACACTCAGCGGTTGCGCAATTGACTGACGTACAATATACGCATCAATTGCACTTGTTCCCTGTG
GGAAATCCTGCACTCTGGTCATCAAATGAGCACTTTCTCCAGTTCCTACAAGATCAATTAACTCCTCAGCATCCTTCTGATACTGCCCGGTAACAATGCC
AGCCCTTTGCAAGAACTCCTCAAGTGTTATCTCCCCAAACGACATCTGTGCCTCACAACCTGAACTCCTTTTCTCGTCATCACTACTCTCCTCTTCCTGC
TGGATGTTTCTCCAAATTTCATCCACTGTCTTCTTGCTCAACGGCAGGGGCACAGTAATGCTGCTGCCCTGACGTTCCAAACCAAAAGCTGACGTGCTGT
GACTGCCTGAATTCCCAGCGCCATTTGGTAATGGAAGGTTCTTCTCATCTGGAAGCACACTCCTCACAAAGTCATCAAGGTTCATACTAAGAAGTGGCGC
ACCGAGGTGGCTTTCAACCTCACTGAGGGTGAGGTTATAGAGAGAGCCTTCCCTGACTAGTGTCTGAATTTGGGCCCTGTTCCGCTTCTTGCCTGTGATG
GCGGTGCCACCGCCTTCAGAGCTCATTTTGCCTGTTTTATGTTTGACCAGTGACACTATTGATGATCAGTTGTTGATAGCATGAAACAGTAAGCTTTCTG
ATTTTGGTAATCCTTGTGCAAAAACTGTTCAGATTTTGATTTATTCAAGCAGGCAATCTTATTGGAGAAGCAGCGAGATGCCTGCAGGGAGGGGATAATC
TGCTGCTCGGTGCGCGATAACTCCGAGGTATCGAGAG
page-top