Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18903  (registered. 2003)
Contig Information
Length 1149 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_OKCS Seed DPA5 1
Wh_PCDAM Anther at meiosis 2
Homology (BLAST) Top Hit vesicle-associated membrane protein-associated protein [Triticum aestivum]
Score 896
Evalue 2.25665e-94
Total Hit Count 457
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18903
AGGTTATGGTGAACGTGACATAACTTGCAGCTGTTAAGAATTATAATTAAAACAAGTCTACTCGATGTGATTAAAATCATGAAAACCACCATGTAATGTA
CACAAACCAAAGCTTCTAAGCCGTTACAAGTTAGAATAGAACAGGCGCTCCTTTTAGGAGTAAAAACACAAGGGATGTTGCTGGTATCCGTCCTTTCCTG
GGAATGTAACTTTGTTGGGGACTACTCTTCTCCTATGTCTTCTTGAGGATGAAACCAGCGATGATGCCCAGAATACCCACCACAATCAAGAAGGTGATTG
AGAAACCGCCGTTGCTTTTGCTGCTCTCTTTGCGTAGGACATCCAGCTCTTGTCTCAACTTCTGGTTTTGCTGAACAGCAGACATTTTCTCCTCAGTTAG
CTTGGAAATCATGGATGTTGCCTCCGAGGACTTCTCCTTTGATGCTTCACCAGATGATCTAAATACAGATTGTGGCAATGTAGAATTAGGGGTCCCATTT
TCCAATGAACGAGCAGAACTCCCTTGTTCTGATTCTTCAGAGAACGGGCTAGGTGAAGATGTTGGCACATAAATTACACGCAGCTTGCATTCATCAACAA
CCTTCCCTGGCTCTTTGTTGAACATTGCTGCACTAATATCTTGAGTTTCTGCGCCATTCTCAGCTGCAACACTTTGAACTAGGAACTTGTCCTTACACTG
CAGATCAGGAGGTGCTTCCCTCTGCGCTTGCATTGTAACTGTAACATCACAAGTCGACCCAGGAAGTACAACGCCAATATTAGGGCGCACACAGTACTGC
TTTGGGTTGGTAGTTTTGACCTTGAATGCTACATAATGGTCGGTCTTATTTGTGAGTTGCATGGAGCACGAGCTCTGCTTCATCAATTCAAAGGGAAATG
CCAGCTCCGAGGGCTGGATCTCGAGGAAACTGGCGCTTCCGGCGCTCATGGTGGCTTCCTCGCAAACAAATCAAGAACTCGAACCACCAAAAAAATTCGC
AGTGGAGAGAGAATTATCTCTGGCTTCCCACGGATTCAATCGGGAAGCCAAGAACGAGGACGCCCACCAATCGATTGGAACAAGAGGTGGGGGAATCCCG
GGGCGGAAAAGTGCGAAAAATTAGGAATTTATTGGTCGCCCTCGCTCTC
page-top