Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18796  (registered. 2003)
Contig Information
Length 892 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 4
Wh_SHC Shoot grown with cold treatment 2
Homology (BLAST) Top Hit Os01g0360600 [Oryza sativa (japonica cultivar-group)] >gi|14587322|dbj|BAB61227.1| putative Dephospho-CoA kinase (27.4 kD) (3K840) [Oryza sativa Japonica Group] >gi|113532552|dbj|BAF04935.1| Os01g0360600 [Oryza sativa (japonica cultivar-group)] >gi|215697395|dbj|BAG91389.1| unnamed protein product [Oryza sativa Japonica Group]
Score 875
Evalue 4.14779e-92
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18796
TTTTTTTTTTACACAAGCAAGCAGTTGCAAATTTTATTTCACTCGAAATTCAGCACTTGTGGTATAATAACTCCAGACATGACAGGACAGTAATCGTGCT
CGCCTAGTGCTCTGCACTGACCCTTCGAAATTTTCAACCAATCAATCTTAGTCCAATCCTAGTTACCTTAACTTCCTAAGCGTGAAAAGATCACAGCAGA
TTCTTCTGAGCAAGTAGAACCCCCGCCGCCGTGCACACGACGATAGAGAGAAGGCCATCCCTGGACATCATGCGCTCCTTCCATGTCAAGGGACCAGACA
CCTGCTTCAGCACTTCCTGGAACTGCTCTTTCGTGTCGTCCAGCGAGCCGGAGTTGTCGATCACTATGTCGGCTTCCGACTTCTTCCAGTCCAACGCAAG
CTGGGCGTCGATCCTGCCCTGAGCCTGTTCCTGGCCGCAACTGTCTCTTGACATGAGCCTCTCGATCTGTGTTTTGGGATCCACCCATACGACAACCACG
GGGTCCGTCCATCGGTCCATCTTTGTCTCAAACAGGAGCGGGATGTCGACGACAATAACCAGGCATCCCTTCACCCAGAGTTTTAGTATCTCCCAGAATA
TACCGCATGAAATGTGTGGGGCCAGAAGACGGTTTAGAAGCTTGCGTTTTTCTGGGTCAGTGAAAACAACCTGACCCAATTGAGCTCTGTCAATTTCTCC
ATTTTCCAACAGAATGCCATTCCCAAAAGCTTTCACAATCTTCTTCCAACCTCCAGTACCTTTCTGCACTACATTCCGAGCCACGACGTCGGCGTCGCCC
ACCGGGACGCCGGCGGACTTGAAGAGGCCGGAGACGGTGCTCTTCCCCGAGGCGATCCCGCCCGTCAGGCCGACCAGCCGCATCTTGAGATC
page-top