Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18747  (registered. 2003)
Contig Information
Length 1601 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMC Dormant seed with cold treatment after water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit Os07g0668200 [Oryza sativa (japonica cultivar-group)] >gi|34393740|dbj|BAC83401.1| putative adenyl cyclase [Oryza sativa Japonica Group] >gi|50510075|dbj|BAD30727.1| putative adenyl cyclase [Oryza sativa Japonica Group] >gi|113612114|dbj|BAF22492.1| Os07g0668200 [Oryza sativa (japonica cultivar-group)] >gi|218200224|gb|EEC82651.1| hypothetical protein OsI_27260 [Oryza sativa Indica Group]
Score 1439
Evalue 3.87177e-157
Total Hit Count 30
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18747
ATCCTCTCCGCCTCTCACCGCGGGTGCGCGGCAGCCGCCGAGCTCGCGCTCCTGCCCCATCTCGAGAATGGCTTCCCCGCCTCGCGCTCCTCTCCAGATC
ACACCAGGAGCTTCTCCTCCCACCTACCTCGTACTTTGCTATCGCGAACCGTAACTTCTCACTGCCGGTGTAAGAAATCAGTGTGCTTGTGTAGCTATGC
ACACTCAAGCGGATATCACATGGCCAGAGCTCATTTGTCGACAGACTCAAGCGGAATCGACCAACCTAAAGAATCTGCAGAGGAGCTGTACCAGAAAATG
CTGAAGTCTGTTGAAGCCCAGACTATGCCGCCAAATGCCTGGTTGTGGTCAATGATCAGTAGTTGCTCCAGTGAGGAGGATATAAAACTTCTCTTTCAGA
TTTTGCAGAAGCTAAGAATATTCAGGCTATCAAATCTTCGCATCAATGCAAACTTCAACGACCATCTCTGTATGAAAGTTTCTGAGGCTTGTGCTCGTGT
GGGTGTCGTTGACTATGGGTTGAAGGTTTTATGGAATCATAATGTTTATGGAATAACGCCAACCATTGGTTCTGCCCATTATCTACTGCAACATGCTAAA
GAGCACAATGATACTAAACTAATGGAGAAGATAATGCAAGTCCTTAGAAGGAATTCCTTGCCATTACAACCAGGCACTGCTGATATTGTCTTCAGTATCT
GCTATAACACTGATAGATGGGATTTACTCTCAAAATATGCGGCAAGATTTGTTCAGGCTGGAGTCAAGTTGCGTCGTACTGCATTTGACGTATGGATGGA
ATTTGCTGCCAAAGTTGGAGATTCTCAATCTATATGGAACATCAATAGCCTGAGAGGCAAGTCTATCAAGCACTATACTCTTACATCAGGTTTTGCATGC
GTAAAGGGGTCTCTGCTTGAACGCAGGCCAGATAATGCAGCCGCCACCATTAAACTTCTTCACAAGCACCTGCCTGATCAGAAGAAACCATTTGTGAAAG
ATGAGCTCCAAAAGCTTGTTGCTGAATGGCCAACAGAGGTGATAAAAAGGCAGAAGAAAGATGAGAGGAAGGCAATGGAGGAAGCTTTGATTGAGGACAT
CCCAAAGATGATCAGCTCCATGGCGAAGTCGGGCCTCGATATTTCCGTGGATCTGGACAAGCTCACCCGTCAGCCTGAAGCAGCGTAGAGAAGCAACACC
GCTGCTGGACACCTCGACGCGGCAGCTGCAAATCCTGCGGCACACCTGATACCCGAGGGCTGAGGAAAACATTTTTGACTGGGTGGGTTGCGGTGATCGG
TTTGACACGGTAGCACTAGAACCCTCCGATAATAACGTGTACACTATTGTTTGGTACTAGATGGAGACATTCTTTTTGGTGGGAACACATGCCGTTCATT
CATCAAATCCATGGACGGCTAATTCTCAACAAAACATCGAGCGCAACACAGTTTGGATTTTGTTTTCAAAGAATTCATGTTCCAAACGGCAAGTAATCTT
AGTGTTTGACTGCCAAATGCAGTAGCAATCATAGGCTTTTTTATCTACATATTCTGTGTCTGAATACATGCTGTCTCATATCCAGATATGAGAGTTATCG
C
page-top