Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18729  (registered. 2003)
Contig Information
Length 659 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_DPA20 Seed DPA20 2
Wh_PCDAM Anther at meiosis 4
Homology (BLAST) Top Hit Os10g0406800 [Oryza sativa (japonica cultivar-group)] >gi|78708600|gb|ABB47575.1| expressed protein [Oryza sativa (japonica cultivar-group)] >gi|113639175|dbj|BAF26480.1| Os10g0406800 [Oryza sativa (japonica cultivar-group)]
Score 599
Evalue 2.32934e-60
Total Hit Count 117
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18729
CAACTTAGAAAGAAAGGGGTTGCTGGCACCATCCGTAACTGTTGCTTTGAAGCTGATACCCAGATACAAAATTTGCTTTCTATAGCAGAATATCTTTGGC
CAGCTCTACTTTTGCCTGTAGCTGGAAAGAAGATCTATAGCGAAGAAGATAGATCGAAAATGCCTCCCGAGCTTGCAAATGCACTTTCTCATGAACGAGA
AGCTGTTGATGATTCTGAAATTCGTGAACGGGCACTGGAGGCTATCTATATGATCGTGATGCAGGATGATGGACGAAAGGCCTTTTGGTCAGTCAATGGG
CCACGGATACTGCAGGTTGGTTATGAAGACGAAGAGGACCTGAAAGTGATGGGAGCATATGAGTTGATTGGTTCTTTGCTTGTCGGTAAGGGTGAAATTG
AACAAGATCAAGAGCAAGGAGAAGATAAGCCTCAATGATGGGCTCAACTATGTACAATTTGTAATCTGTCTTATCTACTTGCTGCAAGAAAACAGGGCTG
TATCGCTTCCAATCTTAAGAATGTTCTGTCGTATGGATCCAAATTTCTTGCAGTAGCTGGCTTGTTCTATCTCCTGGTTTCAGTTTTGTTGTCCACAATT
TCAATGCAACTATGTAAGAGCATTAAGAACATGTTCGGTTTTTGCCTCTAAAAAAAAAA
page-top