Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18643  (registered. 2003)
Contig Information
Length 1022 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_VHS Shoot with heat shock treatment 4
Homology (BLAST) Top Hit hypothetical protein OsJ_014974 [Oryza sativa (japonica cultivar-group)]
Score 1194
Evalue 5.31066e-129
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18643
GCAGTACCGAGTGCAAACCTGCTACGCAATCCTTATACAAACTAACGTGGTCTGTTTATTCATGTACTTGTTCATCCACTCATCAAATAATAATCAATTT
CTTACGTCAAACCCATCCAGTCGCGCCCGAGACGTGGTGCATGGCCGTATTCATCTCCGCAGGCCGAGGAAGGTGAAGATGAAGCGGACGTAGTCGTAGC
GGAAGAGGTGGCGCATCATGGCGATCTTCTGCTCGTCCCACGGCGGGTACCTCAGCATGGCCTCCACCAGGAAGCCCCGCCGCAGCACCGCCTTCTTGTG
GCTGAACATCTCGAACGAGTACTTGCCGTGGTACTGCCCGAACCCGCTCTGCCCCACACCCCCGAACGGCAGCGTGTCCACCCCGAACTGTACGACGGCG
TCGTTGAAGGTGACGCTCCCCGACGACGTCTCCTCCACGATCCGCCGCTTCAGCGGCGCGCTGTCGGTGAAGGCGTACACGGCCAGCGGCTTCGGCCGCG
CCCTCACGAACGCGATGCTGTCCTCGATCTTCTTCACCGTGATGATGGGGAGCAGAGGGCCGAAGATCTCCTCGGTCATGATCGCGGAGTCCAGCGGCGG
GTTCAGCAGTATCGTGGGCTCGATGGACAGGTTCTTGGCGTCCAAGCCGCCGCCGTGCAGGATGGACGCCGCCACCGCCGGGTCCTTGAGGAGGTTACTC
AGACGCTGGAAATGCCGCCCGTTGACGATCCGCGCCATCTGGTCCGAGTCGGCGATGAACCTCTTCAGCGTCGACTTGAGCAACTTGATCAGGGTGGGCG
CAAACCGCTCCTCGACGAGCACGTAGTCGATGGCGATGCAGGCCTGGCCGGCGCAGGACGACCACTTGGCGAAGATCACGCGGTTCACCGAGGTCTGGAG
GTTCCTCCTGCCGGCAACGGCGTCGAAGATGCAGGGGCACTTCCCGCCCAGCTCCAGCGCCACGGGCGTCAGGTGCTTCACCGCCGCCGCCATCACCACG
CGCGCCACGCGCGGGCACCCGG
page-top