Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7206  (registered. 2012)
Contig Information
Length 1073 bp
Clones alternative view 63 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_V4816 Shoot grown under cold condition for 16days 4
Wh_VABA Shoot with ABA treatment 2
Wh_VHS Shoot with heat shock treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 7
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 6
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 6
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XE Seedling, infected with leaf rust 5
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 3
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 4
WH_XX Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|11132027|sp|O04437.1|GSTZ_WHEAT|GSTZ_WHEAT RecName: Full=Glutathione S-transferase; AltName: Full=GST
Score 431
Evalue 6.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig7206
TCCCTTCTCCGGCTCTTCATACCAATAAATATAGTCACATACTGCTGCATCGTCTCCATCTAGTAGTGGAGGAAGAGGAGAAAGGGGTAGCAGGCAGCAA
TGGCGACGGCCAAGCCCATCCTGTACGGCGCCTGGATCAGCTCTTGCTCTCACCGTGTCCGGATCGCTCTCAATCTCAAAGGTGTGGACTATGAGTACAA
GGCAGTCAATCCTCGGACAGATCCAGACTATGAAAAAATAAACCCGATCAAATACATACCAGCATTGGTAGATGGGGACTTTGTTCTATCTGATTCTCTC
GCTATCATGTTGTATCTGGAAGATAAGTATCCTCAGCATCCTCTCGTACCTAAAGATATCAAAACGAAAGGTCTTGATCTTCAGATTGCGAACATAGTTT
GCTCAAGCATCCAACCTCTCCAAGGCTACGGCGTAATTGGTTTGCATGAGGGTAGGTTGAGCCCCGATGAGAGCCTTGAGGTGGTTCAACGTTATATTGA
CAAGGGCTTCAAAGCAATAGAAAAGCTCTTGGATGGATGTGACAGCAAATATTGCGTCGGAGATGAAGTCCATTTGGGAGATGTGTGTCTAGCCCCACAG
ATCCATGCCGCCATCAATCGCTTCCAGATTGATATGACGAAGTACCCAACCTTGTCGCGACTTCACGATGCCTACATGGAAATTCCGGCATTTCAAGCCG
CACTGCCCCAGAATCAGCCAGATGCACCTTCAGCAAAATAATCAAGAAATCAAGCCAGTTACAACTATACGCGTGTAATTTCCACAATAATGAGGAATGT
AGTCTGCAATGCATGGAAGAACCTCTCATAAGTCATAACTTGTCAGTTTGTCTGCGTGTACACGACTTTGTCGTCCATCTAGATGCCATGGCGAGCTGCC
GGCCGGGCTCCGGTACCATGTAAAATTAGTATTGATCGATTCACTGCCAGTAAGATTCAGCAGAAAAAAGAAAGGTGATTTGATGAATTGACCTGTATTT
ATAACTGATGTTCTCTCTTGGATTTGTATTTGTTGCTGGATTTTTTTTGTGGGGGATTTATTGCTGATGTTGA
page-top