Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18598  (registered. 2003)
Contig Information
Length 1220 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_CSEC Callus 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit hypothetical protein OsI_04634 [Oryza sativa Indica Group]
Score 1308
Evalue 4.16793e-142
Total Hit Count 244
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18598
TTTTTTTTTTCGCGGTGTGTTTCAAGTGGACATTAGGGTTTTCCTGCTCATTCCGGTGCGCTAGTGTGTGCGGTCGATGGCACTTGACAAAAAGTAGTAG
GGCCTAGTCCTTGCCTGCCGATCGCTATACCGAAGAAAACTACCTGCGCCTGCGTCTCTTGCCGGTTTCGTCCATGAAGGACTCCCAACCGTCGTGCTCC
AGCTTGCTGAAATCTTCTAACTCCGCAATGGAGAGCAGGTACTGCGTGAGCTTTCGCAGCTCCTGATCGCGGCCTCGGTTCTTACTGGCGTTCTTGAACG
GTCTGATCACGAGGCCGTTCTGTGGGTTCATGACGAAATTCCTCCTGAGGTCATCAAACATGATTGTGTTCTTTTCACTGTAGTGCTCGGGGAACTTGGT
CCAGATGACACCAAGAGGTTTGCAGTCGAAGACCTTCTTGTCAGGAGCATGCACAGTTATCATCGCCATGTGATCCAGAAGGGCGGTGATCTTGTAGTTG
GGATTGCTAAGAACTCCAAGTTGCTCCATCTTCAGCTGCACCCATTTCATATTTGTTGCTGACCATATCATGATATCATACTCTGCGTATGCAGCAGCGA
GAAATTCGTGGAGAAATGGACGCATGAGTTCCAAAGGATTCTCAGCTGGAGACCTATGGTCAAACAGAGTATAGTCAATGTCTAACACAAGCAATCTTTT
TCCATCGCGGCATGGATTCAAGAGCTTGATCTTATACTGGCTTGCACGACGTTTCACTTTTTGCTTGTAGAGAACATTATCCTTGATAGCAGTAACTTCA
TCTTTGAAAAATTCATAATCATCGAGTACCTCTGGATCATCTGGTCGGTCCACAAATATTTCATCTTCAACAGTACCGATCATGGTCAGCTTGCCGTTGG
GCTTGAAGGGGAGGGAGGAAAGGAGGACGGACTCGTCGTTGAGTATGAGCTTGGGGTAGAGAAGCTTCTGGCGTTTGGGGAGCACGTCGGTGAACTCGCA
GATGCGCCGCTTCAGCTCCAACAGCGTGTCGTCCCCCATCGCCCGCACCGTGTACTCCTTCCCGCTCCACTTCACGACCAGCGTAATCTCCTCCGGCGGC
GCCTCCTCCGCCATGAGGGAGATCGCCTCCGGATCCAGCGCCGGCGCAGGGGGCGGGGCCGGGGCCGGGGCCGCCGCCGAGGAAGAGGACGCCTCCGACA
TGGGCTTGGTGGTGTGTGCG
page-top