Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig720  (registered. 2012)
Contig Information
Length 1225 bp
Clones alternative view 45 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Wh_SH - 4
Wh_DPA20 Seed DPA20 4
Wh_EM Dormant seed with water absorption 2
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_V4816 Shoot grown under cold condition for 16days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XN Leaves, plant was grown at constant 23Ž 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 3
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XV Leaves, plant was grown at constant 23Ž 1
WH_F/WH_R 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|168805244|gb|ACA28704.1|| fatty acid desaturase [Sorghum bicolor]
Score 528
Evalue 5.00E-148
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig720
TTTTTTTTTTACTCAAAAAAGTTGCCCTTCCTTCGACGATCAGTTATTCCGCCATAAACACGAAATGGTCTACAACAACATGACACGGACGGGGGGAGAT
GACGCCAATGCAATGACAGACGCACACACAACACACGCGGCCATGTCCACGGCCACGGACACCAACGATGACCGCCGGCCAAACCTAAGCCGACGACTAG
AACGCAGAGAAAAAGTAAAGACGGAACTGACCAAAGTCACGGACACGCTACTCTTCCTTGCACCACTCAGCTCTTCTAGCATTGGCACGGTAATAGTAGT
CTTCTTTTGTGCCCAAATGCCCTCTGCTATCTAAAGACTAACCATATGGACTGTAGGTAGATGGATGGAATTACTTGGTAGGATCTCTTCTCTGAGTTCT
TTCTCCAGCACAGTTGATGGATCTTGGCGGCTAGAACTTGTTGCTGTACCAGAAGACCCCCTTGCGGTCCTCGGGCTCGACGTAGATGCACTCCTTGGCC
TCGCGCCATGTGGCCTTGGCGACGGGGGTGGGGTCGAACTGGTAGTACTCGCCAAGGATGGGCTTGATCGCCTTGGTGGCCTCCATGGCGTGGTAGTGCG
GCATGGTGGAGAAGAGGTGGTGCGCCACGTGCGTGTCCGTGATGTTGTGGAACACGCGGTTGAGGATGCCGTAGTCGCGGTCCATGGTGGCGAGCGCCCC
GCGCAGCCAGTCCCACTCCGTCGAGTCGTAGTGCGGCAGCGCCGGGTGGGTGTGCTGCAGGTAGGTGATCAGGACCAGCCACGCGTTCACGATCAGCAGC
GGCACGCCGTACACCCGCACCACCCACCAGAACCCGAACGACGACACAAGCTTCAGCAGAGCCAACGACACGGCCAGCACTCCCACGTCTGAGATGAAGA
TCTGAGCGCGCTCCCGGTCGTTGTAGATCGGGCCGTAGGGGTCGAAGTGGCAGGCGAAGCGCGGGTACGGGCGGCCCGAGGCGTTGAGCGCCAGGTACAG
CGGCCACCCGAGGGTGAGCTGCACGACGATGTGCACCAGACGGCCGATGGGGTTGTTGTAGATGTAAGGAGTGTACCACGCCAGCGCCTCCTTCTGCTTG
GGGACGAACACCTCATCACGCTCCAGCGACCCGGTGTTGGAGTGGTGGCGACGGTGGCTGTACTTCCACGAGAAGTAGGGGACGAGCAGCCACGAGTGGA
GCACCAGGCCGACGGTGTCGTCGAG
page-top