Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

MUGEST2003_all.Contig18540  (registered. 2003)
Contig Information
Length 806 bp
Clones 6 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 2
Homology (BLAST) Top Hit elicitor-responsive protein 1 [Zea mays]
Score 600
Evalue 2.66745e-60
Total Hit Count 500
Registered year 2003
Contig Sequence     [ Download ]
>MUGEST2003_all.Contig18540
TTCTGTCGTTCGCATTCAGAATCACAATTTCCCCTAGAATAAGAACCACAAATCGACAATTATCGGACCCGACATCTCTAAACTGTTCTGACTTCTGGCT
ACTGGTACTATACATCTTCTAAAAAGCTACAGTTGCAACGTACATACAATTGGAACCACATCGTTCAACCACGGGCATAACTTCCAACGCTAATGCGCTA
CGAGCGAAGTCCTTGGCATCATGCTCTACTCGCGAGAGCTGTGCATCCAGCCTCCGACCTGCGCGCCGTCTTCTTCGACCTTGGTGGCCGTGAACGAGAT
GCCCACTCTGATCTCGCCGTGGTACGAGTTGTCGGCGGAGACGACGCTGTACTTGGCCGGGTTTTGCTGCGACGAGCCGCTCTCCATGCCAAGGGTGATC
AGATCAGTCACATTGATCGTTGCTTGGCCGAGGAAGTCGTCGCTGGAGAAGTTATCGTGGTCCATGATCCGGAGGAAGAGCTTGTGCTGCCCGTTGGCCG
CGGAGGAGTTGATCTGGAACCGGAACACCTCGTTCCAGCTCGGGTTCCTCCCCTCATCTCTGGAGGTGCTGCTCTTGCGCTCCTGGCTCCGGTACTGCAC
CACCACATACGGGTCGATCTTCCCTAGGAAATCGCTGCCGAAGAGGCCCTTGGCGTCGACGAGATGCACCTCCAGCACGCCCCTGCCCATCGCCTCCGGA
TCTAAGCTGGAGACCTGAACGAGCACCTCCTCTGTCCTTTGCCTTCTGGCAGGCCGCTCTGCCTTCTCCTTGTTTCCTCCGGGTCTTGCTGTGATGAGGT
CGCGTT
page-top